Incidental Mutation 'R0051:Hspd1'
ID192632
Institutional Source Beutler Lab
Gene Symbol Hspd1
Ensembl Gene ENSMUSG00000025980
Gene Nameheat shock protein 1 (chaperonin)
SynonymsHsp60
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score33
Status Validated
Chromosome1
Chromosomal Location55077835-55088243 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 55082046 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027123] [ENSMUST00000127861] [ENSMUST00000144077]
Predicted Effect probably benign
Transcript: ENSMUST00000027123
SMART Domains Protein: ENSMUSP00000027123
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 550 1.8e-87 PFAM
low complexity region 557 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127861
SMART Domains Protein: ENSMUSP00000119336
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 202 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144077
SMART Domains Protein: ENSMUSP00000122947
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 142 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit embryonic lethality between E7.5 and E9.75 associated with growth retardation. Males heterozygous for a gene-trap allele produce fewer female offspring than expected. Heterozygotes develop a slowly progressive motor defect resembling spastic paraplegia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Hspd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Hspd1 APN 1 55081126 missense probably damaging 0.98
IGL01896:Hspd1 APN 1 55079109 missense probably benign 0.01
IGL03295:Hspd1 APN 1 55080175 missense probably benign 0.00
R0035:Hspd1 UTSW 1 55083783 missense probably benign 0.05
R0051:Hspd1 UTSW 1 55082046 unclassified probably benign
R1326:Hspd1 UTSW 1 55080259 unclassified probably null
R2163:Hspd1 UTSW 1 55078538 unclassified probably benign
R2851:Hspd1 UTSW 1 55081097 missense probably damaging 1.00
R2852:Hspd1 UTSW 1 55081097 missense probably damaging 1.00
R2853:Hspd1 UTSW 1 55081097 missense probably damaging 1.00
R4196:Hspd1 UTSW 1 55086909 missense probably benign
R5590:Hspd1 UTSW 1 55084769 missense probably damaging 1.00
R5742:Hspd1 UTSW 1 55084607 missense probably benign 0.08
R6600:Hspd1 UTSW 1 55078618 missense probably benign 0.02
R7120:Hspd1 UTSW 1 55079229 missense probably benign 0.01
R7604:Hspd1 UTSW 1 55080337 missense probably benign 0.00
R7814:Hspd1 UTSW 1 55078644 missense possibly damaging 0.90
R7980:Hspd1 UTSW 1 55078626 missense possibly damaging 0.50
R8059:Hspd1 UTSW 1 55081724 missense possibly damaging 0.90
Z1177:Hspd1 UTSW 1 55080266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTGGAATTCACACTTTTGACCTG -3'
(R):5'- TGAACCCCTTAATGCCTATGCCATCT -3'

Sequencing Primer
(F):5'- CTTTTGACCTGTAAATACAGAGAGC -3'
(R):5'- ggaacccagaagaaacagcag -3'
Posted On2014-05-20