Incidental Mutation 'R0051:Ccdc146'
ID192637
Institutional Source Beutler Lab
Gene Symbol Ccdc146
Ensembl Gene ENSMUSG00000064280
Gene Namecoiled-coil domain containing 146
Synonyms4930528G09Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0051 (G1)
Quality Score50
Status Validated
Chromosome5
Chromosomal Location21292961-21424677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21316904 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 374 (R374L)
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000115245] [ENSMUST00000198930]
Predicted Effect probably benign
Transcript: ENSMUST00000030552
SMART Domains Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115245
AA Change: R374L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280
AA Change: R374L

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132473
Predicted Effect probably benign
Transcript: ENSMUST00000198930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Ccdc146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc146 APN 5 21301422 missense possibly damaging 0.93
IGL01066:Ccdc146 APN 5 21319542 missense probably benign 0.03
IGL01399:Ccdc146 APN 5 21294613 missense possibly damaging 0.75
IGL01866:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01868:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01869:Ccdc146 APN 5 21316839 missense probably benign 0.25
IGL02213:Ccdc146 APN 5 21316904 missense probably benign 0.10
IGL02338:Ccdc146 APN 5 21319606 unclassified probably benign
IGL02553:Ccdc146 APN 5 21297633 missense probably benign 0.00
IGL02838:Ccdc146 APN 5 21297569 missense probably benign 0.01
Starcraft UTSW 5 21399614 splice site probably null
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0055:Ccdc146 UTSW 5 21297006 synonymous probably null
R0115:Ccdc146 UTSW 5 21322756 missense possibly damaging 0.87
R0373:Ccdc146 UTSW 5 21319545 missense probably benign 0.00
R1251:Ccdc146 UTSW 5 21293372 missense probably benign 0.00
R1355:Ccdc146 UTSW 5 21321242 missense probably damaging 1.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1556:Ccdc146 UTSW 5 21330553 missense probably damaging 1.00
R1613:Ccdc146 UTSW 5 21294524 missense probably damaging 0.99
R1872:Ccdc146 UTSW 5 21301290 missense probably benign 0.01
R2271:Ccdc146 UTSW 5 21399721 missense probably benign 0.15
R2329:Ccdc146 UTSW 5 21308612 critical splice donor site probably null
R2518:Ccdc146 UTSW 5 21305528 missense probably benign
R2680:Ccdc146 UTSW 5 21305269 missense possibly damaging 0.58
R3116:Ccdc146 UTSW 5 21316955 missense probably benign 0.02
R3121:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3122:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3159:Ccdc146 UTSW 5 21399792 missense unknown
R3436:Ccdc146 UTSW 5 21297005 missense possibly damaging 0.92
R4043:Ccdc146 UTSW 5 21316943 missense probably benign 0.14
R4226:Ccdc146 UTSW 5 21322758 missense probably benign 0.09
R4493:Ccdc146 UTSW 5 21303193 missense possibly damaging 0.92
R5013:Ccdc146 UTSW 5 21333038 missense probably damaging 1.00
R5024:Ccdc146 UTSW 5 21399614 splice site probably null
R5051:Ccdc146 UTSW 5 21303083 missense possibly damaging 0.77
R5384:Ccdc146 UTSW 5 21308713 missense probably benign 0.37
R5532:Ccdc146 UTSW 5 21305331 missense probably benign 0.02
R5906:Ccdc146 UTSW 5 21301352 missense possibly damaging 0.88
R5927:Ccdc146 UTSW 5 21308621 nonsense probably null
R5951:Ccdc146 UTSW 5 21319579 missense possibly damaging 0.84
R5978:Ccdc146 UTSW 5 21316968 missense probably benign 0.02
R5990:Ccdc146 UTSW 5 21318182 missense probably benign 0.41
R6123:Ccdc146 UTSW 5 21305597 missense possibly damaging 0.93
R6217:Ccdc146 UTSW 5 21317902 intron probably null
R6276:Ccdc146 UTSW 5 21301340 missense probably damaging 0.98
R6665:Ccdc146 UTSW 5 21303094 missense probably damaging 1.00
R7077:Ccdc146 UTSW 5 21305274 missense possibly damaging 0.94
R7204:Ccdc146 UTSW 5 21308626 missense probably benign 0.22
R7336:Ccdc146 UTSW 5 21303112 missense probably benign 0.41
R7608:Ccdc146 UTSW 5 21301452 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCAGCTTGATACTGGGTCCTTTAG -3'
(R):5'- CCAACACACAAAAGTAGCTGATTTGGG -3'

Sequencing Primer
(F):5'- GCCAATCaaacaaaacaaaacaaaac -3'
(R):5'- CAAAAGTAGCTGATTTGGGTTTCAC -3'
Posted On2014-05-20