Incidental Mutation 'R0051:Dalrd3'
ID192638
Institutional Source Beutler Lab
Gene Symbol Dalrd3
Ensembl Gene ENSMUSG00000019039
Gene NameDALR anticodon binding domain containing 3
Synonyms6330580J24Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0051 (G1)
Quality Score69
Status Validated
Chromosome9
Chromosomal Location108569886-108572774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108572215 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000141748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000074208] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019183
AA Change: V449A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039
AA Change: V449A

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect possibly damaging
Transcript: ENSMUST00000193427
AA Change: V120A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039
AA Change: V120A

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known. It encodes a protein with a DALR anticodon binding domain similar to that of class Ia aminoacyl tRNA synthetases. This gene is located in a cluster of genes (with a complex sense-anti-sense genome architecture) on chromosome 3, and contains two micro RNA (miRNA) precursors (mir-425 and mir-191) in one of its introns. Preferential expression of this gene (the miRNAs and other genes in the cluster) in testis suggests a role of this gene in spermatogenesis (PMID:19906709). [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Dalrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Dalrd3 APN 9 108571526 unclassified probably benign
IGL02699:Dalrd3 APN 9 108570889 splice site probably benign
IGL02701:Dalrd3 APN 9 108572284 missense possibly damaging 0.95
R0051:Dalrd3 UTSW 9 108572215 missense possibly damaging 0.89
R2025:Dalrd3 UTSW 9 108571085 missense probably benign 0.08
R4425:Dalrd3 UTSW 9 108571601 unclassified probably benign
R4552:Dalrd3 UTSW 9 108572230 missense possibly damaging 0.67
R4660:Dalrd3 UTSW 9 108570369 missense probably benign
R4876:Dalrd3 UTSW 9 108571436 splice site probably benign
R5642:Dalrd3 UTSW 9 108572290 missense probably damaging 1.00
R5854:Dalrd3 UTSW 9 108570077 critical splice donor site probably null
R6342:Dalrd3 UTSW 9 108571123 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTATAACTGTGCCCGCCTTGCC -3'
(R):5'- TGAAATCCATGCTGAGCTGCACC -3'

Sequencing Primer
(F):5'- TTCGAGGGCTACAAACATGG -3'
(R):5'- TTGCATACCTAGAGACAGACGTTG -3'
Posted On2014-05-20