Incidental Mutation 'R0230:Smarca4'
ID192642
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
SynonymsSNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0230 (G1)
Quality Score29
Status Validated
Chromosome9
Chromosomal Location21616169-21704230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21700872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1518 (V1518I)
Ref Sequence ENSEMBL: ENSMUSP00000133922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
Predicted Effect probably benign
Transcript: ENSMUST00000034707
AA Change: V1519I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: V1519I

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098948
AA Change: V1522I

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: V1522I

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174008
AA Change: V1518I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: V1518I

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1411:Smarca4 UTSW 9 21658955 missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R1768:Smarca4 UTSW 9 21701183 missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21639327 missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R5964:Smarca4 UTSW 9 21647430 missense probably benign 0.00
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense probably benign 0.10
R7253:Smarca4 UTSW 9 21658960 missense probably benign 0.01
R7307:Smarca4 UTSW 9 21638800 missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21658933 missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21686247 missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21647625 missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21639075 intron probably null
R7644:Smarca4 UTSW 9 21655654 missense probably benign 0.00
R7734:Smarca4 UTSW 9 21667362 missense possibly damaging 0.65
R7833:Smarca4 UTSW 9 21647359 missense possibly damaging 0.86
R7916:Smarca4 UTSW 9 21647359 missense possibly damaging 0.86
Z1176:Smarca4 UTSW 9 21702957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGAAAAGTCAGCTCAGTGAGGG -3'
(R):5'- AATGCCGAGTCTGTCGTCAGAGTG -3'

Sequencing Primer
(F):5'- TCAGTGAGGGAGGAACTGGTC -3'
(R):5'- CGTTAAGAGAGGCACTGCCTAC -3'
Posted On2014-05-22