Incidental Mutation 'R1760:Slc38a11'
ID192657
Institutional Source Beutler Lab
Gene Symbol Slc38a11
Ensembl Gene ENSMUSG00000061171
Gene Namesolute carrier family 38, member 11
Synonyms9330158F14Rik
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65316430-65364034 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 65355319 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000112420] [ENSMUST00000152324]
Predicted Effect probably null
Transcript: ENSMUST00000112420
SMART Domains Protein: ENSMUSP00000108039
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 32 420 1.6e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124918
SMART Domains Protein: ENSMUSP00000120185
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 26 381 8.5e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124918
SMART Domains Protein: ENSMUSP00000120185
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 26 381 8.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127623
SMART Domains Protein: ENSMUSP00000120737
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 1 345 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145583
Predicted Effect probably null
Transcript: ENSMUST00000152324
SMART Domains Protein: ENSMUSP00000121205
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 32 367 4.8e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155422
Predicted Effect probably null
Transcript: ENSMUST00000155962
SMART Domains Protein: ENSMUSP00000118837
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 30 204 1.1e-30 PFAM
Pfam:Trp_Tyr_perm 31 201 3.8e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155962
SMART Domains Protein: ENSMUSP00000118837
Gene: ENSMUSG00000061171

DomainStartEndE-ValueType
Pfam:Aa_trans 30 204 1.1e-30 PFAM
Pfam:Trp_Tyr_perm 31 201 3.8e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Slc38a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Slc38a11 APN 2 65353782 missense probably damaging 1.00
IGL01467:Slc38a11 APN 2 65316856 missense probably benign 0.00
IGL02585:Slc38a11 APN 2 65335791 missense probably benign 0.01
IGL03001:Slc38a11 APN 2 65353815 missense probably damaging 0.97
R0458:Slc38a11 UTSW 2 65363469 critical splice acceptor site probably null
R0514:Slc38a11 UTSW 2 65316865 missense probably benign 0.08
R0815:Slc38a11 UTSW 2 65353780 missense possibly damaging 0.79
R1695:Slc38a11 UTSW 2 65316971 missense probably damaging 1.00
R1751:Slc38a11 UTSW 2 65350108 missense probably benign 0.44
R1854:Slc38a11 UTSW 2 65363516 intron probably null
R1961:Slc38a11 UTSW 2 65330339 missense possibly damaging 0.65
R1991:Slc38a11 UTSW 2 65330339 missense probably benign 0.22
R2046:Slc38a11 UTSW 2 65358185 missense probably damaging 0.99
R2078:Slc38a11 UTSW 2 65330384 missense possibly damaging 0.81
R2103:Slc38a11 UTSW 2 65330339 missense probably benign 0.22
R3154:Slc38a11 UTSW 2 65330335 missense probably damaging 0.98
R4358:Slc38a11 UTSW 2 65358116 missense probably benign 0.01
R5635:Slc38a11 UTSW 2 65361403 critical splice acceptor site probably null
R5729:Slc38a11 UTSW 2 65317021 missense probably benign 0.00
R6059:Slc38a11 UTSW 2 65334745 missense probably damaging 1.00
R6755:Slc38a11 UTSW 2 65363891 missense probably benign
R7339:Slc38a11 UTSW 2 65326570 missense probably benign
R7360:Slc38a11 UTSW 2 65353795 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGGACATGATAACATACCGAACAGGA -3'
(R):5'- gcaacagaacaaacctcaacaAACAAGT -3'

Sequencing Primer
(F):5'- gctgtcctggaacttactttattg -3'
(R):5'- aacaaacctcaacaAACAAGTTATCC -3'
Posted On2014-05-23