Incidental Mutation 'R1760:Vmn2r75'
ID 192695
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Name vomeronasal 2, receptor 75
Synonyms EG546981
MMRRC Submission 039792-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1760 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 85797250-85820932 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 85798019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 598 (T598K)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
AlphaFold G5E8Z7
Predicted Effect probably damaging
Transcript: ENSMUST00000167830
AA Change: T598K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: T598K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,333,055 (GRCm39) S1585P probably benign Het
Abhd16b T C 2: 181,135,197 (GRCm39) F33S probably damaging Het
Adgra2 G A 8: 27,609,795 (GRCm39) R856Q probably damaging Het
Aff3 A T 1: 38,368,945 (GRCm39) probably benign Het
Anxa2 A T 9: 69,397,049 (GRCm39) Y251F probably benign Het
Arid1b A G 17: 5,392,088 (GRCm39) T1873A probably damaging Het
Baz1b C A 5: 135,271,378 (GRCm39) D1320E probably benign Het
Bbs1 A T 19: 4,944,350 (GRCm39) S426R probably benign Het
Bid A G 6: 120,877,209 (GRCm39) V44A possibly damaging Het
Ccdc60 T A 5: 116,310,532 (GRCm39) M177L probably damaging Het
Cdh23 G A 10: 60,161,855 (GRCm39) T1997M probably damaging Het
Cdh5 T A 8: 104,854,801 (GRCm39) M243K probably benign Het
Clpb T A 7: 101,435,905 (GRCm39) V578E possibly damaging Het
Cngb1 C A 8: 96,026,328 (GRCm39) C151F probably benign Het
Cntnap5b T C 1: 99,700,535 (GRCm39) S16P probably benign Het
Cr1l T A 1: 194,797,123 (GRCm39) M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 (GRCm39) M235K probably damaging Het
Ddx55 A T 5: 124,706,176 (GRCm39) R534W probably damaging Het
Dip2b T A 15: 100,109,910 (GRCm39) L1465Q probably damaging Het
Dnah9 G T 11: 65,872,048 (GRCm39) D2727E probably benign Het
Dph3b-ps A C 13: 106,683,497 (GRCm39) noncoding transcript Het
Dst T A 1: 34,267,684 (GRCm39) L2702Q probably damaging Het
Efnb2 T C 8: 8,673,184 (GRCm39) T158A possibly damaging Het
Exosc10 A T 4: 148,662,926 (GRCm39) K712* probably null Het
Fgr T C 4: 132,725,653 (GRCm39) V354A possibly damaging Het
Fsip2 A G 2: 82,830,185 (GRCm39) D6893G possibly damaging Het
Fsip2 G A 2: 82,815,240 (GRCm39) V3658M probably benign Het
Fsip2 A T 2: 82,818,055 (GRCm39) H4596L possibly damaging Het
Gm1527 G A 3: 28,949,699 (GRCm39) probably benign Het
Gm5150 G T 3: 16,060,468 (GRCm39) Q7K probably benign Het
Gpr155 C T 2: 73,212,279 (GRCm39) V115M probably damaging Het
Gpr75 T C 11: 30,841,527 (GRCm39) L144P probably damaging Het
Gsn T A 2: 35,174,835 (GRCm39) Y127N probably damaging Het
Hk1 A G 10: 62,117,678 (GRCm39) L615S probably damaging Het
Igsf9b A G 9: 27,229,123 (GRCm39) T194A possibly damaging Het
Il17rd C T 14: 26,813,763 (GRCm39) Q46* probably null Het
Jak1 T A 4: 101,020,126 (GRCm39) M678L probably benign Het
Kif6 T C 17: 49,922,311 (GRCm39) V16A probably benign Het
Kpna3 T C 14: 61,607,990 (GRCm39) E405G probably benign Het
Lmtk2 C A 5: 144,110,993 (GRCm39) T571K probably damaging Het
Mucl2 T C 15: 103,927,838 (GRCm39) T40A possibly damaging Het
Myh11 G A 16: 14,051,559 (GRCm39) probably benign Het
Myh7 C T 14: 55,210,170 (GRCm39) R1845Q probably damaging Het
Myo1f T A 17: 33,805,172 (GRCm39) L480Q probably benign Het
Nek9 T G 12: 85,352,364 (GRCm39) D833A possibly damaging Het
Nek9 T C 12: 85,357,184 (GRCm39) E660G probably benign Het
Or10z1 C T 1: 174,077,926 (GRCm39) C189Y probably damaging Het
Or2a12 A G 6: 42,904,431 (GRCm39) I89V possibly damaging Het
Or2t45 A G 11: 58,669,195 (GRCm39) M81V possibly damaging Het
Or5h18 T C 16: 58,847,350 (GRCm39) R307G probably benign Het
Or6c65 T A 10: 129,603,417 (GRCm39) D17E probably benign Het
Or6f2 G A 7: 139,756,188 (GRCm39) V52M probably damaging Het
Or7s1a-ps1 T A 9: 18,843,791 (GRCm39) probably benign Het
Otud3 G T 4: 138,623,092 (GRCm39) T383K possibly damaging Het
Pkp4 T C 2: 59,142,185 (GRCm39) L496P probably damaging Het
Pla2g4e C A 2: 120,000,527 (GRCm39) A737S possibly damaging Het
Pla2g4f T C 2: 120,144,547 (GRCm39) probably benign Het
Plxnd1 A T 6: 115,944,740 (GRCm39) V1018E possibly damaging Het
Ppp1r21 T G 17: 88,869,653 (GRCm39) V402G possibly damaging Het
Prkcq T G 2: 11,304,881 (GRCm39) M690R probably damaging Het
Ptpra T C 2: 130,391,747 (GRCm39) I719T probably damaging Het
Rab3ip C T 10: 116,773,415 (GRCm39) D133N probably damaging Het
Relch T G 1: 105,647,169 (GRCm39) probably benign Het
Rsbn1 T A 3: 103,867,347 (GRCm39) Y563N probably damaging Het
Rtf1 A C 2: 119,558,889 (GRCm39) D530A probably benign Het
Rybp G T 6: 100,209,224 (GRCm39) S199R probably benign Het
Sema5a T G 15: 32,641,252 (GRCm39) C689G probably damaging Het
Senp6 T A 9: 80,025,911 (GRCm39) V314E probably benign Het
Setd1a T A 7: 127,385,062 (GRCm39) C47S possibly damaging Het
Slamf1 C A 1: 171,604,734 (GRCm39) T168K probably benign Het
Slc12a5 T C 2: 164,838,048 (GRCm39) S937P probably damaging Het
Slc38a11 C T 2: 65,185,663 (GRCm39) probably null Het
Slc6a2 C T 8: 93,687,846 (GRCm39) probably benign Het
Snw1 A T 12: 87,511,459 (GRCm39) F64Y probably benign Het
Spata9 A C 13: 76,146,643 (GRCm39) I172L probably benign Het
Sphkap T C 1: 83,255,265 (GRCm39) H828R probably benign Het
Spmip6 T A 4: 41,507,330 (GRCm39) probably null Het
Tmem94 A T 11: 115,687,580 (GRCm39) K1146N probably damaging Het
Trdn A G 10: 33,109,883 (GRCm39) T294A possibly damaging Het
Tsc22d1 T C 14: 76,654,388 (GRCm39) V289A possibly damaging Het
Tti1 C A 2: 157,834,955 (GRCm39) V1002L possibly damaging Het
Tubgcp4 T A 2: 121,019,952 (GRCm39) probably null Het
Ush2a G A 1: 188,643,180 (GRCm39) E4181K possibly damaging Het
Uvrag A G 7: 98,537,555 (GRCm39) S547P probably benign Het
Vav3 T C 3: 109,248,443 (GRCm39) V30A possibly damaging Het
Vegfa A G 17: 46,336,395 (GRCm39) Y242H probably damaging Het
Vps13b C T 15: 35,884,765 (GRCm39) S3146L possibly damaging Het
Vrk3 A G 7: 44,417,895 (GRCm39) Y310C probably damaging Het
Zfhx4 A G 3: 5,447,676 (GRCm39) K1100R probably benign Het
Zfp748 T A 13: 67,693,540 (GRCm39) probably null Het
Zfp760 A T 17: 21,941,311 (GRCm39) D162V probably damaging Het
Znfx1 T A 2: 166,881,786 (GRCm39) M1068L probably damaging Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 85,797,240 (GRCm39) unclassified probably benign
IGL01287:Vmn2r75 APN 7 85,797,801 (GRCm39) missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 85,814,774 (GRCm39) missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 85,820,870 (GRCm39) nonsense probably null
IGL01406:Vmn2r75 APN 7 85,812,500 (GRCm39) splice site probably benign
IGL01615:Vmn2r75 APN 7 85,797,681 (GRCm39) missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 85,813,455 (GRCm39) missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 85,814,786 (GRCm39) missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 85,814,348 (GRCm39) missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 85,814,974 (GRCm39) missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 85,797,911 (GRCm39) missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 85,797,644 (GRCm39) missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 85,820,933 (GRCm39) unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 85,814,791 (GRCm39) missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0083:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 85,797,515 (GRCm39) missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 85,814,288 (GRCm39) missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 85,814,721 (GRCm39) missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 85,797,449 (GRCm39) nonsense probably null
R0631:Vmn2r75 UTSW 7 85,812,478 (GRCm39) missense probably null 1.00
R0661:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 85,813,476 (GRCm39) missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 85,797,798 (GRCm39) missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 85,814,850 (GRCm39) missense possibly damaging 0.85
R1970:Vmn2r75 UTSW 7 85,797,470 (GRCm39) missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 85,814,372 (GRCm39) missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 85,798,144 (GRCm39) missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 85,797,629 (GRCm39) missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 85,813,494 (GRCm39) missense probably null 1.00
R4532:Vmn2r75 UTSW 7 85,797,349 (GRCm39) nonsense probably null
R4583:Vmn2r75 UTSW 7 85,813,290 (GRCm39) missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 85,815,494 (GRCm39) missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 85,812,378 (GRCm39) missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 85,797,611 (GRCm39) missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 85,820,787 (GRCm39) missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 85,814,705 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 85,814,735 (GRCm39) missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 85,813,372 (GRCm39) missense probably benign
R5156:Vmn2r75 UTSW 7 85,813,436 (GRCm39) missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 85,813,447 (GRCm39) missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 85,815,500 (GRCm39) missense probably benign
R5574:Vmn2r75 UTSW 7 85,815,510 (GRCm39) missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 85,797,702 (GRCm39) missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 85,820,779 (GRCm39) missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 85,814,578 (GRCm39) missense probably benign
R6021:Vmn2r75 UTSW 7 85,820,820 (GRCm39) missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 85,814,482 (GRCm39) missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 85,820,784 (GRCm39) missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 85,813,287 (GRCm39) missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 85,813,453 (GRCm39) missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 85,797,644 (GRCm39) missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 85,815,568 (GRCm39) missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R8411:Vmn2r75 UTSW 7 85,797,722 (GRCm39) missense probably damaging 1.00
R8507:Vmn2r75 UTSW 7 85,797,685 (GRCm39) nonsense probably null
R8559:Vmn2r75 UTSW 7 85,815,480 (GRCm39) missense possibly damaging 0.65
R8677:Vmn2r75 UTSW 7 85,814,410 (GRCm39) missense possibly damaging 0.86
R8708:Vmn2r75 UTSW 7 85,812,476 (GRCm39) missense probably damaging 0.99
R8778:Vmn2r75 UTSW 7 85,813,497 (GRCm39) missense probably benign 0.40
R8968:Vmn2r75 UTSW 7 85,820,765 (GRCm39) nonsense probably null
R9145:Vmn2r75 UTSW 7 85,813,447 (GRCm39) missense probably damaging 1.00
R9316:Vmn2r75 UTSW 7 85,797,313 (GRCm39) missense possibly damaging 0.63
R9363:Vmn2r75 UTSW 7 85,815,423 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGCAGCCACAGTGAATGCAAT -3'
(R):5'- TTGGAACAAATTCTATGCAGGCTCCAT -3'

Sequencing Primer
(F):5'- TGCAATGGCAAATGCAGTCTG -3'
(R):5'- TCTCCATGCATTAATTCAGTGTATC -3'
Posted On 2014-05-23