Incidental Mutation 'R1760:Cdh23'
ID192709
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Namecadherin 23 (otocadherin)
Synonymsnmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R1760 (G1)
Quality Score152
Status Validated
Chromosome10
Chromosomal Location60302748-60696490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60326076 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1997 (T1997M)
Ref Sequence ENSEMBL: ENSMUSP00000101104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073242
AA Change: T1998M

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: T1998M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
AA Change: T1999M

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: T1999M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105462
AA Change: T2001M

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: T2001M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
AA Change: T1999M

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: T1999M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105464
AA Change: T1997M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: T1997M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7573:Cdh23 UTSW 10 60323550 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGCACGAATTCCCTAAAGTTGCCTC -3'
(R):5'- ATTCAGTCTGTCAAGGCTGCCG -3'

Sequencing Primer
(F):5'- tgatgacaccccccaacc -3'
(R):5'- CCCCAGGGCCTCCCTAC -3'
Posted On2014-05-23