Incidental Mutation 'R1760:Rab3ip'
ID 192711
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1760 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 116905784-116950769 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116937510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 133 (D133N)
Ref Sequence ENSEMBL: ENSMUSP00000151326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000218391] [ENSMUST00000219109] [ENSMUST00000219603]
AlphaFold Q68EF0
Predicted Effect probably damaging
Transcript: ENSMUST00000020375
AA Change: D133N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: D133N

low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218391
Predicted Effect probably damaging
Transcript: ENSMUST00000219109
AA Change: D133N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219603
AA Change: D133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116939378 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
R9085:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116914161 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtggtgatgatggtttttctg -3'
Posted On 2014-05-23