Incidental Mutation 'R1760:Kpna3'
ID192725
Institutional Source Beutler Lab
Gene Symbol Kpna3
Ensembl Gene ENSMUSG00000021929
Gene Namekaryopherin (importin) alpha 3
SynonymsIPOA4
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61365211-61439874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61370541 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 405 (E405G)
Ref Sequence ENSEMBL: ENSMUSP00000022496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022496]
Predicted Effect probably benign
Transcript: ENSMUST00000022496
AA Change: E405G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022496
Gene: ENSMUSG00000021929
AA Change: E405G

DomainStartEndE-ValueType
Pfam:IBB 7 93 1e-25 PFAM
ARM 103 144 9.52e-11 SMART
ARM 146 186 2.15e-9 SMART
ARM 188 229 8.59e0 SMART
ARM 232 271 1.78e-1 SMART
ARM 273 313 4.31e-9 SMART
ARM 315 355 5.91e-7 SMART
ARM 357 397 5.22e-8 SMART
ARM 400 440 1.51e-4 SMART
Pfam:Arm_3 447 499 5.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225207
Meta Mutation Damage Score 0.1194 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Kpna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kpna3 APN 14 61374288 missense possibly damaging 0.94
IGL00321:Kpna3 APN 14 61391853 splice site probably benign
IGL01013:Kpna3 APN 14 61370517 missense probably damaging 1.00
IGL01833:Kpna3 APN 14 61370445 missense possibly damaging 0.92
IGL02661:Kpna3 APN 14 61372949 splice site probably benign
IGL03070:Kpna3 APN 14 61370782 splice site probably benign
R1428:Kpna3 UTSW 14 61383220 splice site probably benign
R1719:Kpna3 UTSW 14 61387477 missense probably damaging 1.00
R1728:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R1784:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R2107:Kpna3 UTSW 14 61370484 missense possibly damaging 0.52
R4184:Kpna3 UTSW 14 61368175 missense probably damaging 0.96
R4952:Kpna3 UTSW 14 61370389 missense probably damaging 1.00
R5081:Kpna3 UTSW 14 61391245 missense probably damaging 0.97
R5766:Kpna3 UTSW 14 61403014 missense probably benign 0.07
R5887:Kpna3 UTSW 14 61403012 missense probably benign 0.04
R5927:Kpna3 UTSW 14 61384647 missense probably damaging 0.96
R7116:Kpna3 UTSW 14 61368186 missense probably benign 0.32
R7615:Kpna3 UTSW 14 61372962 missense possibly damaging 0.81
R7674:Kpna3 UTSW 14 61367637 missense probably benign
R7799:Kpna3 UTSW 14 61384733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATTCCAGGGGCACTCCTTAC -3'
(R):5'- CAGGCAATCAGCAGCAAGTTCAAG -3'

Sequencing Primer
(F):5'- GGGCACTCCTTACCTCCAC -3'
(R):5'- ATTCATCAGCTCGCTAAGGTCAG -3'
Posted On2014-05-23