Mutagenetix > Incidental Mutations

Incidental Mutation 'R1760:Dip2b'

192729

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

039792-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.704) question?

Stock #

R1760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100212029 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1465 (L1465Q)

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023768
AA Change: L1231Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: L1231Q

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100203
AA Change: L1465Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: L1465Q

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108971
AA Change: L1231Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: L1231Q

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Meta Mutation Damage Score

0.8867

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	A	4: 41,507,330		probably null	Het
2310035C23Rik	T	G	1: 105,719,444		probably benign	Het
Abca2	T	C	2: 25,443,043	S1585P	probably benign	Het
Abhd16b	T	C	2: 181,493,404	F33S	probably damaging	Het
Adgra2	G	A	8: 27,119,767	R856Q	probably damaging	Het
Aff3	A	T	1: 38,329,864		probably benign	Het
Anxa2	A	T	9: 69,489,767	Y251F	probably benign	Het
Arid1b	A	G	17: 5,341,813	T1873A	probably damaging	Het
Baz1b	C	A	5: 135,242,524	D1320E	probably benign	Het
Bbs1	A	T	19: 4,894,322	S426R	probably benign	Het
Bid	A	G	6: 120,900,248	V44A	possibly damaging	Het
Ccdc60	T	A	5: 116,172,473	M177L	probably damaging	Het
Cdh23	G	A	10: 60,326,076	T1997M	probably damaging	Het
Cdh5	T	A	8: 104,128,169	M243K	probably benign	Het
Clpb	T	A	7: 101,786,698	V578E	possibly damaging	Het
Cngb1	C	A	8: 95,299,700	C151F	probably benign	Het
Cntnap5b	T	C	1: 99,772,810	S16P	probably benign	Het
Cr1l	T	A	1: 195,114,815	M305L	probably benign	Het
Ctnnal1	A	T	4: 56,838,988	M235K	probably damaging	Het
Ddx55	A	T	5: 124,568,113	R534W	probably damaging	Het
Dnah9	G	T	11: 65,981,222	D2727E	probably benign	Het
Dph3b-ps	A	C	13: 106,546,989		noncoding transcript	Het
Dst	T	A	1: 34,228,603	L2702Q	probably damaging	Het
Efnb2	T	C	8: 8,623,184	T158A	possibly damaging	Het
Exosc10	A	T	4: 148,578,469	K712*	probably null	Het
Fgr	T	C	4: 132,998,342	V354A	possibly damaging	Het
Fsip2	G	A	2: 82,984,896	V3658M	probably benign	Het
Fsip2	A	T	2: 82,987,711	H4596L	possibly damaging	Het
Fsip2	A	G	2: 82,999,841	D6893G	possibly damaging	Het
Gm1527	G	A	3: 28,895,550		probably benign	Het
Gm5150	G	T	3: 16,006,304	Q7K	probably benign	Het
Gpr155	C	T	2: 73,381,935	V115M	probably damaging	Het
Gpr75	T	C	11: 30,891,527	L144P	probably damaging	Het
Gsn	T	A	2: 35,284,823	Y127N	probably damaging	Het
Hk1	A	G	10: 62,281,899	L615S	probably damaging	Het
Igsf9b	A	G	9: 27,317,827	T194A	possibly damaging	Het
Il17rd	C	T	14: 27,091,806	Q46*	probably null	Het
Jak1	T	A	4: 101,162,929	M678L	probably benign	Het
Kif6	T	C	17: 49,615,283	V16A	probably benign	Het
Kpna3	T	C	14: 61,370,541	E405G	probably benign	Het
Lmtk2	C	A	5: 144,174,175	T571K	probably damaging	Het
Mucl2	T	C	15: 103,897,572	T40A	possibly damaging	Het
Myh11	G	A	16: 14,233,695		probably benign	Het
Myh7	C	T	14: 54,972,713	R1845Q	probably damaging	Het
Myo1f	T	A	17: 33,586,198	L480Q	probably benign	Het
Nek9	T	G	12: 85,305,590	D833A	possibly damaging	Het
Nek9	T	C	12: 85,310,410	E660G	probably benign	Het
Olfr186	T	C	16: 59,026,987	R307G	probably benign	Het
Olfr315	A	G	11: 58,778,369	M81V	possibly damaging	Het
Olfr419	C	T	1: 174,250,360	C189Y	probably damaging	Het
Olfr446	A	G	6: 42,927,497	I89V	possibly damaging	Het
Olfr523	G	A	7: 140,176,275	V52M	probably damaging	Het
Olfr808	T	A	10: 129,767,548	D17E	probably benign	Het
Olfr831-ps1	T	A	9: 18,932,495		probably benign	Het
Otud3	G	T	4: 138,895,781	T383K	possibly damaging	Het
Pkp4	T	C	2: 59,311,841	L496P	probably damaging	Het
Pla2g4e	C	A	2: 120,170,046	A737S	possibly damaging	Het
Pla2g4f	T	C	2: 120,314,066		probably benign	Het
Plxnd1	A	T	6: 115,967,779	V1018E	possibly damaging	Het
Ppp1r21	T	G	17: 88,562,225	V402G	possibly damaging	Het
Prkcq	T	G	2: 11,300,070	M690R	probably damaging	Het
Ptpra	T	C	2: 130,549,827	I719T	probably damaging	Het
Rab3ip	C	T	10: 116,937,510	D133N	probably damaging	Het
Rsbn1	T	A	3: 103,960,031	Y563N	probably damaging	Het
Rtf1	A	C	2: 119,728,408	D530A	probably benign	Het
Rybp	G	T	6: 100,232,263	S199R	probably benign	Het
Sema5a	T	G	15: 32,641,106	C689G	probably damaging	Het
Senp6	T	A	9: 80,118,629	V314E	probably benign	Het
Setd1a	T	A	7: 127,785,890	C47S	possibly damaging	Het
Slamf1	C	A	1: 171,777,166	T168K	probably benign	Het
Slc12a5	T	C	2: 164,996,128	S937P	probably damaging	Het
Slc38a11	C	T	2: 65,355,319		probably null	Het
Slc6a2	C	T	8: 92,961,218		probably benign	Het
Snw1	A	T	12: 87,464,689	F64Y	probably benign	Het
Spata9	A	C	13: 75,998,524	I172L	probably benign	Het
Sphkap	T	C	1: 83,277,544	H828R	probably benign	Het
Tmem94	A	T	11: 115,796,754	K1146N	probably damaging	Het
Trdn	A	G	10: 33,233,887	T294A	possibly damaging	Het
Tsc22d1	T	C	14: 76,416,948	V289A	possibly damaging	Het
Tti1	C	A	2: 157,993,035	V1002L	possibly damaging	Het
Tubgcp4	T	A	2: 121,189,471		probably null	Het
Ush2a	G	A	1: 188,910,983	E4181K	possibly damaging	Het
Uvrag	A	G	7: 98,888,348	S547P	probably benign	Het
Vav3	T	C	3: 109,341,127	V30A	possibly damaging	Het
Vegfa	A	G	17: 46,025,469	Y242H	probably damaging	Het
Vmn2r75	G	T	7: 86,148,811	T598K	probably damaging	Het
Vps13b	C	T	15: 35,884,619	S3146L	possibly damaging	Het
Vrk3	A	G	7: 44,768,471	Y310C	probably damaging	Het
Zfhx4	A	G	3: 5,382,616	K1100R	probably benign	Het
Zfp748	T	A	13: 67,545,421		probably null	Het
Zfp760	A	T	17: 21,722,330	D162V	probably damaging	Het
Znfx1	T	A	2: 167,039,866	M1068L	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATCCAGACTCAGTGATGTGTCCC -3'
(R):5'- TGATTGAGACAGGCTTTGAGACCAC -3'

Sequencing Primer
(F):5'- CTCTCTCATGGAGCAAGTAGCAG -3'
(R):5'- CTTGAGGGGTGCCACATGG -3'

Posted On

2014-05-23