Incidental Mutation 'R1760:Dip2b'
ID 192729
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 039792-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R1760 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100109910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1465 (L1465Q)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: L1231Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: L1231Q

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: L1465Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: L1465Q

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: L1231Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: L1231Q

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.8867 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,333,055 (GRCm39) S1585P probably benign Het
Abhd16b T C 2: 181,135,197 (GRCm39) F33S probably damaging Het
Adgra2 G A 8: 27,609,795 (GRCm39) R856Q probably damaging Het
Aff3 A T 1: 38,368,945 (GRCm39) probably benign Het
Anxa2 A T 9: 69,397,049 (GRCm39) Y251F probably benign Het
Arid1b A G 17: 5,392,088 (GRCm39) T1873A probably damaging Het
Baz1b C A 5: 135,271,378 (GRCm39) D1320E probably benign Het
Bbs1 A T 19: 4,944,350 (GRCm39) S426R probably benign Het
Bid A G 6: 120,877,209 (GRCm39) V44A possibly damaging Het
Ccdc60 T A 5: 116,310,532 (GRCm39) M177L probably damaging Het
Cdh23 G A 10: 60,161,855 (GRCm39) T1997M probably damaging Het
Cdh5 T A 8: 104,854,801 (GRCm39) M243K probably benign Het
Clpb T A 7: 101,435,905 (GRCm39) V578E possibly damaging Het
Cngb1 C A 8: 96,026,328 (GRCm39) C151F probably benign Het
Cntnap5b T C 1: 99,700,535 (GRCm39) S16P probably benign Het
Cr1l T A 1: 194,797,123 (GRCm39) M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 (GRCm39) M235K probably damaging Het
Ddx55 A T 5: 124,706,176 (GRCm39) R534W probably damaging Het
Dnah9 G T 11: 65,872,048 (GRCm39) D2727E probably benign Het
Dph3b-ps A C 13: 106,683,497 (GRCm39) noncoding transcript Het
Dst T A 1: 34,267,684 (GRCm39) L2702Q probably damaging Het
Efnb2 T C 8: 8,673,184 (GRCm39) T158A possibly damaging Het
Exosc10 A T 4: 148,662,926 (GRCm39) K712* probably null Het
Fgr T C 4: 132,725,653 (GRCm39) V354A possibly damaging Het
Fsip2 A G 2: 82,830,185 (GRCm39) D6893G possibly damaging Het
Fsip2 G A 2: 82,815,240 (GRCm39) V3658M probably benign Het
Fsip2 A T 2: 82,818,055 (GRCm39) H4596L possibly damaging Het
Gm1527 G A 3: 28,949,699 (GRCm39) probably benign Het
Gm5150 G T 3: 16,060,468 (GRCm39) Q7K probably benign Het
Gpr155 C T 2: 73,212,279 (GRCm39) V115M probably damaging Het
Gpr75 T C 11: 30,841,527 (GRCm39) L144P probably damaging Het
Gsn T A 2: 35,174,835 (GRCm39) Y127N probably damaging Het
Hk1 A G 10: 62,117,678 (GRCm39) L615S probably damaging Het
Igsf9b A G 9: 27,229,123 (GRCm39) T194A possibly damaging Het
Il17rd C T 14: 26,813,763 (GRCm39) Q46* probably null Het
Jak1 T A 4: 101,020,126 (GRCm39) M678L probably benign Het
Kif6 T C 17: 49,922,311 (GRCm39) V16A probably benign Het
Kpna3 T C 14: 61,607,990 (GRCm39) E405G probably benign Het
Lmtk2 C A 5: 144,110,993 (GRCm39) T571K probably damaging Het
Mucl2 T C 15: 103,927,838 (GRCm39) T40A possibly damaging Het
Myh11 G A 16: 14,051,559 (GRCm39) probably benign Het
Myh7 C T 14: 55,210,170 (GRCm39) R1845Q probably damaging Het
Myo1f T A 17: 33,805,172 (GRCm39) L480Q probably benign Het
Nek9 T G 12: 85,352,364 (GRCm39) D833A possibly damaging Het
Nek9 T C 12: 85,357,184 (GRCm39) E660G probably benign Het
Or10z1 C T 1: 174,077,926 (GRCm39) C189Y probably damaging Het
Or2a12 A G 6: 42,904,431 (GRCm39) I89V possibly damaging Het
Or2t45 A G 11: 58,669,195 (GRCm39) M81V possibly damaging Het
Or5h18 T C 16: 58,847,350 (GRCm39) R307G probably benign Het
Or6c65 T A 10: 129,603,417 (GRCm39) D17E probably benign Het
Or6f2 G A 7: 139,756,188 (GRCm39) V52M probably damaging Het
Or7s1a-ps1 T A 9: 18,843,791 (GRCm39) probably benign Het
Otud3 G T 4: 138,623,092 (GRCm39) T383K possibly damaging Het
Pkp4 T C 2: 59,142,185 (GRCm39) L496P probably damaging Het
Pla2g4e C A 2: 120,000,527 (GRCm39) A737S possibly damaging Het
Pla2g4f T C 2: 120,144,547 (GRCm39) probably benign Het
Plxnd1 A T 6: 115,944,740 (GRCm39) V1018E possibly damaging Het
Ppp1r21 T G 17: 88,869,653 (GRCm39) V402G possibly damaging Het
Prkcq T G 2: 11,304,881 (GRCm39) M690R probably damaging Het
Ptpra T C 2: 130,391,747 (GRCm39) I719T probably damaging Het
Rab3ip C T 10: 116,773,415 (GRCm39) D133N probably damaging Het
Relch T G 1: 105,647,169 (GRCm39) probably benign Het
Rsbn1 T A 3: 103,867,347 (GRCm39) Y563N probably damaging Het
Rtf1 A C 2: 119,558,889 (GRCm39) D530A probably benign Het
Rybp G T 6: 100,209,224 (GRCm39) S199R probably benign Het
Sema5a T G 15: 32,641,252 (GRCm39) C689G probably damaging Het
Senp6 T A 9: 80,025,911 (GRCm39) V314E probably benign Het
Setd1a T A 7: 127,385,062 (GRCm39) C47S possibly damaging Het
Slamf1 C A 1: 171,604,734 (GRCm39) T168K probably benign Het
Slc12a5 T C 2: 164,838,048 (GRCm39) S937P probably damaging Het
Slc38a11 C T 2: 65,185,663 (GRCm39) probably null Het
Slc6a2 C T 8: 93,687,846 (GRCm39) probably benign Het
Snw1 A T 12: 87,511,459 (GRCm39) F64Y probably benign Het
Spata9 A C 13: 76,146,643 (GRCm39) I172L probably benign Het
Sphkap T C 1: 83,255,265 (GRCm39) H828R probably benign Het
Spmip6 T A 4: 41,507,330 (GRCm39) probably null Het
Tmem94 A T 11: 115,687,580 (GRCm39) K1146N probably damaging Het
Trdn A G 10: 33,109,883 (GRCm39) T294A possibly damaging Het
Tsc22d1 T C 14: 76,654,388 (GRCm39) V289A possibly damaging Het
Tti1 C A 2: 157,834,955 (GRCm39) V1002L possibly damaging Het
Tubgcp4 T A 2: 121,019,952 (GRCm39) probably null Het
Ush2a G A 1: 188,643,180 (GRCm39) E4181K possibly damaging Het
Uvrag A G 7: 98,537,555 (GRCm39) S547P probably benign Het
Vav3 T C 3: 109,248,443 (GRCm39) V30A possibly damaging Het
Vegfa A G 17: 46,336,395 (GRCm39) Y242H probably damaging Het
Vmn2r75 G T 7: 85,798,019 (GRCm39) T598K probably damaging Het
Vps13b C T 15: 35,884,765 (GRCm39) S3146L possibly damaging Het
Vrk3 A G 7: 44,417,895 (GRCm39) Y310C probably damaging Het
Zfhx4 A G 3: 5,447,676 (GRCm39) K1100R probably benign Het
Zfp748 T A 13: 67,693,540 (GRCm39) probably null Het
Zfp760 A T 17: 21,941,311 (GRCm39) D162V probably damaging Het
Znfx1 T A 2: 166,881,786 (GRCm39) M1068L probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCCAGACTCAGTGATGTGTCCC -3'
(R):5'- TGATTGAGACAGGCTTTGAGACCAC -3'

Sequencing Primer
(F):5'- CTCTCTCATGGAGCAAGTAGCAG -3'
(R):5'- CTTGAGGGGTGCCACATGG -3'
Posted On 2014-05-23