Mutagenetix > Incidental Mutation

Incidental Mutation 'R1760:Arid1b'

192733

Institutional Source

Beutler Lab

Gene Symbol

Arid1b

Ensembl Gene

ENSMUSG00000069729

Gene Name

AT rich interactive domain 1B (SWI-like)

Synonyms

B230217J03Rik, 9330189K18Rik

MMRRC Submission

039792-MU

Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Essential gene?

Possibly essential (E-score: 0.713) question?

Stock #

R1760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4994332-5347656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5341813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1873 (T1873A)

Ref Sequence

ENSEMBL: ENSMUSP00000156119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]

AlphaFold

E9Q4N7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092723
AA Change: T1820A

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: T1820A

Domain	Start	End	E-Value	Type
low complexity region	2	51	N/A	INTRINSIC
low complexity region	69	132	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	201	224	N/A	INTRINSIC
low complexity region	232	247	N/A	INTRINSIC
low complexity region	257	276	N/A	INTRINSIC
low complexity region	301	371	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	438	476	N/A	INTRINSIC
low complexity region	485	499	N/A	INTRINSIC
low complexity region	538	558	N/A	INTRINSIC
low complexity region	574	591	N/A	INTRINSIC
low complexity region	596	611	N/A	INTRINSIC
low complexity region	615	640	N/A	INTRINSIC
low complexity region	691	707	N/A	INTRINSIC
low complexity region	719	740	N/A	INTRINSIC
low complexity region	743	773	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	912	930	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	974	985	N/A	INTRINSIC
low complexity region	1036	1045	N/A	INTRINSIC
ARID	1057	1147	9.9e-33	SMART
BRIGHT	1061	1152	7.62e-41	SMART
low complexity region	1166	1177	N/A	INTRINSIC
low complexity region	1257	1268	N/A	INTRINSIC
low complexity region	1336	1364	N/A	INTRINSIC
low complexity region	1426	1456	N/A	INTRINSIC
low complexity region	1473	1486	N/A	INTRINSIC
low complexity region	1579	1595	N/A	INTRINSIC
coiled coil region	1724	1745	N/A	INTRINSIC
low complexity region	1835	1843	N/A	INTRINSIC
Pfam:DUF3518	1933	2189	1.5e-152	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115797
AA Change: T1821A

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: T1821A

Domain	Start	End	E-Value	Type
low complexity region	17	80	N/A	INTRINSIC
low complexity region	87	98	N/A	INTRINSIC
low complexity region	149	172	N/A	INTRINSIC
low complexity region	180	195	N/A	INTRINSIC
low complexity region	205	224	N/A	INTRINSIC
low complexity region	249	319	N/A	INTRINSIC
low complexity region	327	355	N/A	INTRINSIC
low complexity region	386	424	N/A	INTRINSIC
low complexity region	433	447	N/A	INTRINSIC
low complexity region	486	506	N/A	INTRINSIC
low complexity region	522	539	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
low complexity region	563	588	N/A	INTRINSIC
low complexity region	639	655	N/A	INTRINSIC
low complexity region	667	688	N/A	INTRINSIC
low complexity region	691	721	N/A	INTRINSIC
low complexity region	753	764	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	884	900	N/A	INTRINSIC
low complexity region	922	933	N/A	INTRINSIC
Blast:ARID	981	1028	1e-8	BLAST
low complexity region	1029	1054	N/A	INTRINSIC
ARID	1058	1148	9.9e-33	SMART
BRIGHT	1062	1153	7.62e-41	SMART
low complexity region	1167	1178	N/A	INTRINSIC
low complexity region	1258	1269	N/A	INTRINSIC
low complexity region	1337	1365	N/A	INTRINSIC
low complexity region	1427	1457	N/A	INTRINSIC
low complexity region	1474	1487	N/A	INTRINSIC
low complexity region	1580	1596	N/A	INTRINSIC
coiled coil region	1725	1746	N/A	INTRINSIC
low complexity region	1836	1844	N/A	INTRINSIC
Pfam:DUF3518	1935	2190	6.3e-121	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115799
AA Change: T1339A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: T1339A

Domain	Start	End	E-Value	Type
low complexity region	34	54	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	92	107	N/A	INTRINSIC
low complexity region	111	136	N/A	INTRINSIC
low complexity region	187	203	N/A	INTRINSIC
low complexity region	215	236	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	402	418	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
Blast:ARID	499	546	1e-8	BLAST
low complexity region	547	572	N/A	INTRINSIC
ARID	576	666	9.9e-33	SMART
BRIGHT	580	671	7.62e-41	SMART
low complexity region	685	696	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	855	883	N/A	INTRINSIC
low complexity region	945	975	N/A	INTRINSIC
low complexity region	992	1005	N/A	INTRINSIC
low complexity region	1098	1114	N/A	INTRINSIC
coiled coil region	1243	1264	N/A	INTRINSIC
low complexity region	1354	1362	N/A	INTRINSIC
Pfam:DUF3518	1452	1708	1.1e-152	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000232180
AA Change: T1873A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Meta Mutation Damage Score

0.0663

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	A	4: 41,507,330		probably null	Het
2310035C23Rik	T	G	1: 105,719,444		probably benign	Het
Abca2	T	C	2: 25,443,043	S1585P	probably benign	Het
Abhd16b	T	C	2: 181,493,404	F33S	probably damaging	Het
Adgra2	G	A	8: 27,119,767	R856Q	probably damaging	Het
Aff3	A	T	1: 38,329,864		probably benign	Het
Anxa2	A	T	9: 69,489,767	Y251F	probably benign	Het
Baz1b	C	A	5: 135,242,524	D1320E	probably benign	Het
Bbs1	A	T	19: 4,894,322	S426R	probably benign	Het
Bid	A	G	6: 120,900,248	V44A	possibly damaging	Het
Ccdc60	T	A	5: 116,172,473	M177L	probably damaging	Het
Cdh23	G	A	10: 60,326,076	T1997M	probably damaging	Het
Cdh5	T	A	8: 104,128,169	M243K	probably benign	Het
Clpb	T	A	7: 101,786,698	V578E	possibly damaging	Het
Cngb1	C	A	8: 95,299,700	C151F	probably benign	Het
Cntnap5b	T	C	1: 99,772,810	S16P	probably benign	Het
Cr1l	T	A	1: 195,114,815	M305L	probably benign	Het
Ctnnal1	A	T	4: 56,838,988	M235K	probably damaging	Het
Ddx55	A	T	5: 124,568,113	R534W	probably damaging	Het
Dip2b	T	A	15: 100,212,029	L1465Q	probably damaging	Het
Dnah9	G	T	11: 65,981,222	D2727E	probably benign	Het
Dph3b-ps	A	C	13: 106,546,989		noncoding transcript	Het
Dst	T	A	1: 34,228,603	L2702Q	probably damaging	Het
Efnb2	T	C	8: 8,623,184	T158A	possibly damaging	Het
Exosc10	A	T	4: 148,578,469	K712*	probably null	Het
Fgr	T	C	4: 132,998,342	V354A	possibly damaging	Het
Fsip2	G	A	2: 82,984,896	V3658M	probably benign	Het
Fsip2	A	T	2: 82,987,711	H4596L	possibly damaging	Het
Fsip2	A	G	2: 82,999,841	D6893G	possibly damaging	Het
Gm1527	G	A	3: 28,895,550		probably benign	Het
Gm5150	G	T	3: 16,006,304	Q7K	probably benign	Het
Gpr155	C	T	2: 73,381,935	V115M	probably damaging	Het
Gpr75	T	C	11: 30,891,527	L144P	probably damaging	Het
Gsn	T	A	2: 35,284,823	Y127N	probably damaging	Het
Hk1	A	G	10: 62,281,899	L615S	probably damaging	Het
Igsf9b	A	G	9: 27,317,827	T194A	possibly damaging	Het
Il17rd	C	T	14: 27,091,806	Q46*	probably null	Het
Jak1	T	A	4: 101,162,929	M678L	probably benign	Het
Kif6	T	C	17: 49,615,283	V16A	probably benign	Het
Kpna3	T	C	14: 61,370,541	E405G	probably benign	Het
Lmtk2	C	A	5: 144,174,175	T571K	probably damaging	Het
Mucl2	T	C	15: 103,897,572	T40A	possibly damaging	Het
Myh11	G	A	16: 14,233,695		probably benign	Het
Myh7	C	T	14: 54,972,713	R1845Q	probably damaging	Het
Myo1f	T	A	17: 33,586,198	L480Q	probably benign	Het
Nek9	T	G	12: 85,305,590	D833A	possibly damaging	Het
Nek9	T	C	12: 85,310,410	E660G	probably benign	Het
Olfr186	T	C	16: 59,026,987	R307G	probably benign	Het
Olfr315	A	G	11: 58,778,369	M81V	possibly damaging	Het
Olfr419	C	T	1: 174,250,360	C189Y	probably damaging	Het
Olfr446	A	G	6: 42,927,497	I89V	possibly damaging	Het
Olfr523	G	A	7: 140,176,275	V52M	probably damaging	Het
Olfr808	T	A	10: 129,767,548	D17E	probably benign	Het
Olfr831-ps1	T	A	9: 18,932,495		probably benign	Het
Otud3	G	T	4: 138,895,781	T383K	possibly damaging	Het
Pkp4	T	C	2: 59,311,841	L496P	probably damaging	Het
Pla2g4e	C	A	2: 120,170,046	A737S	possibly damaging	Het
Pla2g4f	T	C	2: 120,314,066		probably benign	Het
Plxnd1	A	T	6: 115,967,779	V1018E	possibly damaging	Het
Ppp1r21	T	G	17: 88,562,225	V402G	possibly damaging	Het
Prkcq	T	G	2: 11,300,070	M690R	probably damaging	Het
Ptpra	T	C	2: 130,549,827	I719T	probably damaging	Het
Rab3ip	C	T	10: 116,937,510	D133N	probably damaging	Het
Rsbn1	T	A	3: 103,960,031	Y563N	probably damaging	Het
Rtf1	A	C	2: 119,728,408	D530A	probably benign	Het
Rybp	G	T	6: 100,232,263	S199R	probably benign	Het
Sema5a	T	G	15: 32,641,106	C689G	probably damaging	Het
Senp6	T	A	9: 80,118,629	V314E	probably benign	Het
Setd1a	T	A	7: 127,785,890	C47S	possibly damaging	Het
Slamf1	C	A	1: 171,777,166	T168K	probably benign	Het
Slc12a5	T	C	2: 164,996,128	S937P	probably damaging	Het
Slc38a11	C	T	2: 65,355,319		probably null	Het
Slc6a2	C	T	8: 92,961,218		probably benign	Het
Snw1	A	T	12: 87,464,689	F64Y	probably benign	Het
Spata9	A	C	13: 75,998,524	I172L	probably benign	Het
Sphkap	T	C	1: 83,277,544	H828R	probably benign	Het
Tmem94	A	T	11: 115,796,754	K1146N	probably damaging	Het
Trdn	A	G	10: 33,233,887	T294A	possibly damaging	Het
Tsc22d1	T	C	14: 76,416,948	V289A	possibly damaging	Het
Tti1	C	A	2: 157,993,035	V1002L	possibly damaging	Het
Tubgcp4	T	A	2: 121,189,471		probably null	Het
Ush2a	G	A	1: 188,910,983	E4181K	possibly damaging	Het
Uvrag	A	G	7: 98,888,348	S547P	probably benign	Het
Vav3	T	C	3: 109,341,127	V30A	possibly damaging	Het
Vegfa	A	G	17: 46,025,469	Y242H	probably damaging	Het
Vmn2r75	G	T	7: 86,148,811	T598K	probably damaging	Het
Vps13b	C	T	15: 35,884,619	S3146L	possibly damaging	Het
Vrk3	A	G	7: 44,768,471	Y310C	probably damaging	Het
Zfhx4	A	G	3: 5,382,616	K1100R	probably benign	Het
Zfp748	T	A	13: 67,545,421		probably null	Het
Zfp760	A	T	17: 21,722,330	D162V	probably damaging	Het
Znfx1	T	A	2: 167,039,866	M1068L	probably damaging	Het

Other mutations in Arid1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Arid1b	APN	17	5337110	missense	possibly damaging	0.77
IGL00340:Arid1b	APN	17	5321284	missense	probably damaging	1.00
IGL00886:Arid1b	APN	17	5126979	missense	probably damaging	0.99
IGL01161:Arid1b	APN	17	5342399	missense	probably damaging	1.00
IGL01391:Arid1b	APN	17	5318858	splice site	probably benign
IGL01456:Arid1b	APN	17	5291235	missense	probably damaging	1.00
IGL02152:Arid1b	APN	17	5313968	missense	probably damaging	1.00
IGL02288:Arid1b	APN	17	5264040	missense	possibly damaging	0.88
IGL02713:Arid1b	APN	17	5343011	missense	probably damaging	1.00
IGL02858:Arid1b	APN	17	5341891	missense	possibly damaging	0.92
IGL02885:Arid1b	APN	17	5342153	missense	probably damaging	1.00
IGL02989:Arid1b	APN	17	5335047	missense	probably damaging	1.00
FR4449:Arid1b	UTSW	17	4995589	small insertion	probably benign
PIT4142001:Arid1b	UTSW	17	5339243	missense	probably damaging	1.00
R0048:Arid1b	UTSW	17	5314034	critical splice donor site	probably null
R0124:Arid1b	UTSW	17	5339330	missense	probably damaging	1.00
R0153:Arid1b	UTSW	17	5342932	missense	probably damaging	1.00
R0465:Arid1b	UTSW	17	4996260	missense	possibly damaging	0.68
R0825:Arid1b	UTSW	17	5342178	missense	probably damaging	1.00
R1172:Arid1b	UTSW	17	5339300	missense	probably damaging	1.00
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1616:Arid1b	UTSW	17	5339294	missense	probably damaging	1.00
R1754:Arid1b	UTSW	17	5279201	critical splice acceptor site	probably null
R1812:Arid1b	UTSW	17	5337029	missense	probably benign	0.10
R1911:Arid1b	UTSW	17	5342966	missense	probably damaging	1.00
R3874:Arid1b	UTSW	17	5336515	splice site	probably null
R3913:Arid1b	UTSW	17	5342257	missense	possibly damaging	0.94
R3916:Arid1b	UTSW	17	5342653	missense	probably benign	0.25
R3922:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R4119:Arid1b	UTSW	17	4995794	unclassified	probably benign
R4290:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4291:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4352:Arid1b	UTSW	17	5097584	missense	possibly damaging	0.93
R4386:Arid1b	UTSW	17	4994972	unclassified	probably benign
R4458:Arid1b	UTSW	17	5242916	missense	probably damaging	0.99
R4524:Arid1b	UTSW	17	5097620	missense	possibly damaging	0.93
R4622:Arid1b	UTSW	17	4995050	unclassified	probably benign
R4723:Arid1b	UTSW	17	5337290	missense	probably benign	0.01
R4782:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4799:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4910:Arid1b	UTSW	17	5342203	missense	probably damaging	1.00
R4946:Arid1b	UTSW	17	5342843	missense	probably damaging	0.99
R5083:Arid1b	UTSW	17	5314018	missense	possibly damaging	0.54
R5204:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R5347:Arid1b	UTSW	17	5291057	nonsense	probably null
R5553:Arid1b	UTSW	17	5313877	missense	probably damaging	1.00
R5713:Arid1b	UTSW	17	5336816	missense	probably damaging	1.00
R5820:Arid1b	UTSW	17	4996254	missense	possibly damaging	0.96
R5992:Arid1b	UTSW	17	4994956	unclassified	probably benign
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6153:Arid1b	UTSW	17	5242832	missense	probably damaging	1.00
R6222:Arid1b	UTSW	17	5327647	critical splice acceptor site	probably null
R6249:Arid1b	UTSW	17	5279361	missense	possibly damaging	0.61
R6279:Arid1b	UTSW	17	5341999	missense	probably damaging	1.00
R6329:Arid1b	UTSW	17	5337263	nonsense	probably null
R6368:Arid1b	UTSW	17	5332533	missense	possibly damaging	0.64
R6466:Arid1b	UTSW	17	5327678	missense	probably damaging	1.00
R6861:Arid1b	UTSW	17	5327686	missense	possibly damaging	0.93
R7008:Arid1b	UTSW	17	5290979	missense	probably damaging	1.00
R7270:Arid1b	UTSW	17	4996043	missense	unknown
R7514:Arid1b	UTSW	17	5341714	missense	probably benign	0.28
R7519:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7519:Arid1b	UTSW	17	4995853	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995860	small insertion	probably benign
R7521:Arid1b	UTSW	17	5342590	missense	probably benign	0.06
R7616:Arid1b	UTSW	17	4995386	missense	unknown
R7654:Arid1b	UTSW	17	5291085	missense	possibly damaging	0.46
R7711:Arid1b	UTSW	17	5336820	missense	probably benign	0.28
R7828:Arid1b	UTSW	17	5097668	missense	probably damaging	1.00
R7864:Arid1b	UTSW	17	5342255	missense	probably damaging	1.00
R7998:Arid1b	UTSW	17	5327684	missense	probably damaging	1.00
R8105:Arid1b	UTSW	17	5291243	missense	possibly damaging	0.81
R8260:Arid1b	UTSW	17	5332513	missense	probably benign	0.03
R8374:Arid1b	UTSW	17	5342644	missense	possibly damaging	0.95
R8779:Arid1b	UTSW	17	5341534	missense	probably benign	0.03
R8801:Arid1b	UTSW	17	5336828	missense	probably benign	0.05
R8894:Arid1b	UTSW	17	5327393	missense	probably damaging	0.98
R8982:Arid1b	UTSW	17	5243041	missense	probably damaging	0.98
R9034:Arid1b	UTSW	17	5336905	missense	probably benign	0.01
R9272:Arid1b	UTSW	17	5336604	missense	possibly damaging	0.80
R9300:Arid1b	UTSW	17	5242999	missense	probably damaging	1.00
R9332:Arid1b	UTSW	17	4995309	missense	unknown
R9481:Arid1b	UTSW	17	5318732	missense	probably damaging	1.00
R9493:Arid1b	UTSW	17	4996148	missense	unknown
R9512:Arid1b	UTSW	17	5341589	missense	probably benign	0.00
R9548:Arid1b	UTSW	17	5334987	missense	probably damaging	1.00
RF007:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995596	small insertion	probably benign
RF028:Arid1b	UTSW	17	4995598	small insertion	probably benign
RF032:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF033:Arid1b	UTSW	17	4995585	small insertion	probably benign
RF041:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF045:Arid1b	UTSW	17	4995583	small insertion	probably benign
RF046:Arid1b	UTSW	17	4995590	small insertion	probably benign
RF058:Arid1b	UTSW	17	4995583	small insertion	probably benign
X0023:Arid1b	UTSW	17	5342393	missense	probably benign	0.39
X0027:Arid1b	UTSW	17	5342372	nonsense	probably null
Z1177:Arid1b	UTSW	17	4996328	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- ATGACAGCCAGTCCCTGGAAGATG -3'
(R):5'- GCCTGCTGGATTCCAAAGGGAAAC -3'

Sequencing Primer
(F):5'- ggaagaggaggaggaggaag -3'
(R):5'- TTCCAAAGGGAAACTTGCCG -3'

Posted On

2014-05-23