Mutagenetix > Incidental Mutations

Incidental Mutation 'R1761:Cr2'

192741

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

039793-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R1761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 195155123 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000082321

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably benign
Transcript: ENSMUST00000193356

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000195120

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

probably null
Transcript: ENSMUST00000210219

Predicted Effect

probably null
Transcript: ENSMUST00000210219

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,507,223	P109L	probably damaging	Het
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Acan	T	A	7: 79,094,085	Y621*	probably null	Het
Aig1	T	C	10: 13,690,584	Y152C	probably damaging	Het
Arhgap33	C	T	7: 30,533,063		probably null	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Cbx5	T	C	15: 103,213,180	D10G	possibly damaging	Het
Ccdc191	A	G	16: 43,943,510	I445V	probably benign	Het
Cdk4	T	A	10: 127,064,677		probably benign	Het
Chil6	A	G	3: 106,394,338	F149L	probably damaging	Het
Cntn5	T	C	9: 10,172,054	T42A	probably benign	Het
Cpn2	A	T	16: 30,260,196	I229N	probably damaging	Het
Cpne8	A	G	15: 90,648,618	V62A	probably damaging	Het
Crnn	A	T	3: 93,148,651	H248L	probably benign	Het
Csn1s1	A	G	5: 87,679,035	S254G	probably benign	Het
Cubn	A	G	2: 13,489,317		probably null	Het
Dnah8	A	G	17: 30,779,916	N3525S	probably damaging	Het
Dpp3	A	G	19: 4,921,149	L220P	probably benign	Het
Fam110a	T	C	2: 151,970,205	E215G	probably benign	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Fat4	T	C	3: 38,887,489	V177A	possibly damaging	Het
Fzd8	C	T	18: 9,213,643	R242C	probably damaging	Het
Gimap5	A	T	6: 48,753,261	Q255L	probably damaging	Het
Gm13083	T	C	4: 143,615,868	Y182H	probably benign	Het
Gm4787	A	G	12: 81,377,176	L736S	probably benign	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Gpr179	A	C	11: 97,335,106	S2074R	probably benign	Het
Hddc2	G	T	10: 31,326,139	D161Y	probably damaging	Het
Hlcs	T	C	16: 94,268,007	D265G	probably benign	Het
Hspg2	A	T	4: 137,514,673	I573F	possibly damaging	Het
Il1b	T	C	2: 129,365,181	K220E	probably damaging	Het
Il5	T	C	11: 53,723,730	I66T	probably damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Lmf2	A	G	15: 89,352,713	V442A	possibly damaging	Het
Mcm2	T	C	6: 88,889,788	I412M	possibly damaging	Het
Mlkl	T	A	8: 111,333,723	L18F	possibly damaging	Het
Mug2	C	A	6: 122,074,705	H949N	probably benign	Het
Nf1	T	C	11: 79,384,265	F51L	probably damaging	Het
Olfr1049	T	G	2: 86,255,039	Y218S	probably damaging	Het
Olfr592	T	G	7: 103,187,118	C172W	probably damaging	Het
Olfr77	A	T	9: 19,921,149	*313C	probably null	Het
P3h2	T	C	16: 25,985,050	E322G	probably damaging	Het
Psmg2	CTTCAGTT	CTTCAGTTCAGTT	18: 67,646,025		probably null	Het
Ptdss1	T	C	13: 66,956,412	V116A	possibly damaging	Het
Ranbp2	T	C	10: 58,485,741	V2620A	probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Scg3	T	A	9: 75,676,758	I154F	probably damaging	Het
Scgn	A	T	13: 23,959,706	F225Y	probably damaging	Het
Sec61b	T	C	4: 47,480,137	C58R	possibly damaging	Het
Slc25a46	G	T	18: 31,607,262	Q96K	possibly damaging	Het
Sptb	A	G	12: 76,612,608	F1173L	probably damaging	Het
Srcap	T	A	7: 127,534,845	C893S	probably damaging	Het
Tet3	T	C	6: 83,403,659	E509G	probably damaging	Het
Timm10b	C	T	7: 105,683,708	R897*	probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Tti1	T	C	2: 158,007,697	I541V	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Vgll3	A	T	16: 65,839,728	D310V	probably damaging	Het
Vmac	A	G	17: 56,715,788	L74P	probably damaging	Het
Zbtb1	A	T	12: 76,385,821	K194*	probably null	Het
Zfp429	A	G	13: 67,396,076	M76T	probably benign	Het
Zfp808	T	A	13: 62,171,646	C230S	possibly damaging	Het
Zfp980	A	G	4: 145,702,042	Y447C	probably damaging	Het
Zfp985	A	G	4: 147,584,045	T457A	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGAAGCTGCACCTCACTAGCAAG -3'
(R):5'- CTAACTCATTGCCCCGATCCAGAAG -3'

Sequencing Primer
(F):5'- GAAGGTCAGCTTCATTCTTCATTAC -3'
(R):5'- GATCCAGAAGTCAAACATGGTTAC -3'

Posted On

2014-05-23