Incidental Mutation 'R1761:Tom1'
ID 192777
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Name target of myb1 trafficking protein
Synonyms
MMRRC Submission 039793-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1761 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 75760333-75796749 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75778179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000077891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000211869] [ENSMUST00000212299] [ENSMUST00000212388] [ENSMUST00000212564] [ENSMUST00000212651]
AlphaFold O88746
Predicted Effect probably benign
Transcript: ENSMUST00000078847
AA Change: V87A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165630
AA Change: V87A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211938
Predicted Effect probably benign
Transcript: ENSMUST00000212299
Predicted Effect probably benign
Transcript: ENSMUST00000212388
Predicted Effect probably benign
Transcript: ENSMUST00000212564
AA Change: Y61H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212651
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,488,672 (GRCm39) H1268Y possibly damaging Het
Acan T A 7: 78,743,833 (GRCm39) Y621* probably null Het
Aig1 T C 10: 13,566,328 (GRCm39) Y152C probably damaging Het
Arhgap33 C T 7: 30,232,488 (GRCm39) probably null Het
Bcl6 G T 16: 23,796,292 (GRCm39) A45D probably damaging Het
Cbx5 T C 15: 103,121,607 (GRCm39) D10G possibly damaging Het
Ccdc191 A G 16: 43,763,873 (GRCm39) I445V probably benign Het
Cdk4 T A 10: 126,900,546 (GRCm39) probably benign Het
Chil6 A G 3: 106,301,654 (GRCm39) F149L probably damaging Het
Cntn5 T C 9: 10,172,059 (GRCm39) T42A probably benign Het
Cpn2 A T 16: 30,079,014 (GRCm39) I229N probably damaging Het
Cpne8 A G 15: 90,532,821 (GRCm39) V62A probably damaging Het
Cr2 A G 1: 194,837,431 (GRCm39) probably null Het
Crnn A T 3: 93,055,958 (GRCm39) H248L probably benign Het
Csn1s1 A G 5: 87,826,894 (GRCm39) S254G probably benign Het
Cubn A G 2: 13,494,128 (GRCm39) probably null Het
Dnah8 A G 17: 30,998,890 (GRCm39) N3525S probably damaging Het
Dpp3 A G 19: 4,971,177 (GRCm39) L220P probably benign Het
Fam110a T C 2: 151,812,125 (GRCm39) E215G probably benign Het
Fam20a A T 11: 109,568,664 (GRCm39) N287K probably damaging Het
Fat4 T C 3: 38,941,638 (GRCm39) V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 (GRCm39) R242C probably damaging Het
Gimap5 A T 6: 48,730,195 (GRCm39) Q255L probably damaging Het
Gm4787 A G 12: 81,423,950 (GRCm39) L736S probably benign Het
Gmeb1 G A 4: 131,962,198 (GRCm39) Q154* probably null Het
Gpr156 T C 16: 37,807,929 (GRCm39) L192P probably damaging Het
Gpr179 A C 11: 97,225,932 (GRCm39) S2074R probably benign Het
Hddc2 G T 10: 31,202,135 (GRCm39) D161Y probably damaging Het
Hlcs T C 16: 94,068,866 (GRCm39) D265G probably benign Het
Hspg2 A T 4: 137,241,984 (GRCm39) I573F possibly damaging Het
Il1b T C 2: 129,207,101 (GRCm39) K220E probably damaging Het
Il5 T C 11: 53,614,557 (GRCm39) I66T probably damaging Het
Irf6 G A 1: 192,851,609 (GRCm39) R400H probably damaging Het
Klra1 A T 6: 130,349,836 (GRCm39) Y201N probably damaging Het
Lmf2 A G 15: 89,236,916 (GRCm39) V442A possibly damaging Het
Mcm2 T C 6: 88,866,770 (GRCm39) I412M possibly damaging Het
Mlkl T A 8: 112,060,355 (GRCm39) L18F possibly damaging Het
Mug2 C A 6: 122,051,664 (GRCm39) H949N probably benign Het
Nf1 T C 11: 79,275,091 (GRCm39) F51L probably damaging Het
Or52j3 T G 7: 102,836,325 (GRCm39) C172W probably damaging Het
Or7d10 A T 9: 19,832,445 (GRCm39) *313C probably null Het
Or8k18 T G 2: 86,085,383 (GRCm39) Y218S probably damaging Het
P3h2 T C 16: 25,803,800 (GRCm39) E322G probably damaging Het
Pramel21 T C 4: 143,342,438 (GRCm39) Y182H probably benign Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,779,095 (GRCm39) probably null Het
Ptdss1 T C 13: 67,104,476 (GRCm39) V116A possibly damaging Het
Ranbp2 T C 10: 58,321,563 (GRCm39) V2620A probably benign Het
Robo2 A G 16: 73,831,912 (GRCm39) V256A probably damaging Het
Scg3 T A 9: 75,584,040 (GRCm39) I154F probably damaging Het
Scgn A T 13: 24,143,689 (GRCm39) F225Y probably damaging Het
Sec61b T C 4: 47,480,137 (GRCm39) C58R possibly damaging Het
Slc25a46 G T 18: 31,740,315 (GRCm39) Q96K possibly damaging Het
Spmip6 G A 4: 41,507,223 (GRCm39) P109L probably damaging Het
Sptb A G 12: 76,659,382 (GRCm39) F1173L probably damaging Het
Srcap T A 7: 127,134,017 (GRCm39) C893S probably damaging Het
Tet3 T C 6: 83,380,641 (GRCm39) E509G probably damaging Het
Timm10b C T 7: 105,332,915 (GRCm39) R897* probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tti1 T C 2: 157,849,617 (GRCm39) I541V probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubb1 A G 2: 174,298,689 (GRCm39) S124G probably benign Het
Vgll3 A T 16: 65,636,614 (GRCm39) D310V probably damaging Het
Vmac A G 17: 57,022,788 (GRCm39) L74P probably damaging Het
Zbtb1 A T 12: 76,432,595 (GRCm39) K194* probably null Het
Zfp429 A G 13: 67,544,195 (GRCm39) M76T probably benign Het
Zfp808 T A 13: 62,319,460 (GRCm39) C230S possibly damaging Het
Zfp980 A G 4: 145,428,612 (GRCm39) Y447C probably damaging Het
Zfp985 A G 4: 147,668,502 (GRCm39) T457A probably benign Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75,778,802 (GRCm39) missense probably benign 0.27
IGL00979:Tom1 APN 8 75,781,331 (GRCm39) unclassified probably benign
IGL01143:Tom1 APN 8 75,785,085 (GRCm39) missense probably benign 0.00
IGL02825:Tom1 APN 8 75,783,883 (GRCm39) missense probably damaging 1.00
R0335:Tom1 UTSW 8 75,791,020 (GRCm39) critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75,778,934 (GRCm39) splice site probably benign
R1317:Tom1 UTSW 8 75,778,179 (GRCm39) missense probably benign 0.03
R1509:Tom1 UTSW 8 75,781,259 (GRCm39) missense probably damaging 1.00
R1691:Tom1 UTSW 8 75,778,227 (GRCm39) missense probably damaging 1.00
R1906:Tom1 UTSW 8 75,778,218 (GRCm39) missense probably damaging 1.00
R3966:Tom1 UTSW 8 75,785,867 (GRCm39) missense probably benign 0.05
R5004:Tom1 UTSW 8 75,778,630 (GRCm39) missense probably damaging 1.00
R5513:Tom1 UTSW 8 75,783,848 (GRCm39) missense probably damaging 0.99
R5906:Tom1 UTSW 8 75,776,886 (GRCm39) missense probably damaging 1.00
R6147:Tom1 UTSW 8 75,781,320 (GRCm39) missense possibly damaging 0.90
R6964:Tom1 UTSW 8 75,778,593 (GRCm39) missense probably null 1.00
R7010:Tom1 UTSW 8 75,778,603 (GRCm39) missense probably damaging 0.98
R7131:Tom1 UTSW 8 75,783,877 (GRCm39) missense possibly damaging 0.88
R7147:Tom1 UTSW 8 75,783,895 (GRCm39) missense probably damaging 1.00
R8701:Tom1 UTSW 8 75,778,796 (GRCm39) missense probably benign 0.00
R9081:Tom1 UTSW 8 75,778,151 (GRCm39) missense probably damaging 1.00
R9278:Tom1 UTSW 8 75,783,883 (GRCm39) missense probably damaging 1.00
R9344:Tom1 UTSW 8 75,785,076 (GRCm39) missense probably damaging 1.00
R9563:Tom1 UTSW 8 75,787,177 (GRCm39) missense probably benign 0.11
R9647:Tom1 UTSW 8 75,785,495 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGTAGGAAGGGAGTCTTGTCTGTC -3'
(R):5'- GCAGCTCACTAGCAGAGTAGAATAGCC -3'

Sequencing Primer
(F):5'- GTCTGTCCTGTCATGTCCCAG -3'
(R):5'- GAGTAGAATAGCCCCAGAATTCC -3'
Posted On 2014-05-23