Incidental Mutation 'R1761:Olfr77'
ID 192780
Institutional Source Beutler Lab
Gene Symbol Olfr77
Ensembl Gene ENSMUSG00000051118
Gene Name olfactory receptor 77
Synonyms MOR143-1, 18A, GA_x6K02T2PVTD-13660026-13660964
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1761 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 19916865-19929124 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 19921149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Cysteine at position 313 (*313C)
Ref Sequence ENSEMBL: ENSMUSP00000149055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057596] [ENSMUST00000217347]
AlphaFold Q8VEY9
Predicted Effect probably null
Transcript: ENSMUST00000057596
AA Change: *313C
SMART Domains Protein: ENSMUSP00000058810
Gene: ENSMUSG00000051118
AA Change: *313C

Pfam:7tm_4 31 308 3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217347
AA Change: *313C
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably benign Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Olfr77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Olfr77 APN 9 19920949 missense possibly damaging 0.87
IGL01318:Olfr77 APN 9 19920758 missense probably benign 0.44
IGL01547:Olfr77 APN 9 19920901 missense probably benign 0.00
IGL01635:Olfr77 APN 9 19920484 missense probably damaging 1.00
IGL02112:Olfr77 APN 9 19920525 missense possibly damaging 0.48
IGL02858:Olfr77 APN 9 19920451 missense probably damaging 0.99
IGL02904:Olfr77 APN 9 19921097 missense probably damaging 1.00
IGL02956:Olfr77 APN 9 19921052 missense possibly damaging 0.87
IGL03066:Olfr77 APN 9 19920371 missense probably benign 0.12
R0662:Olfr77 UTSW 9 19920500 missense probably damaging 1.00
R1222:Olfr77 UTSW 9 19921048 missense possibly damaging 0.87
R1572:Olfr77 UTSW 9 19920912 missense probably benign 0.35
R2409:Olfr77 UTSW 9 19920776 missense probably benign 0.31
R2409:Olfr77 UTSW 9 19920781 missense probably damaging 1.00
R3621:Olfr77 UTSW 9 19920913 missense probably damaging 0.99
R3849:Olfr77 UTSW 9 19920809 missense probably damaging 1.00
R3850:Olfr77 UTSW 9 19920809 missense probably damaging 1.00
R4277:Olfr77 UTSW 9 19920389 missense possibly damaging 0.91
R4768:Olfr77 UTSW 9 19920545 missense possibly damaging 0.56
R4979:Olfr77 UTSW 9 19920359 missense probably benign 0.03
R5276:Olfr77 UTSW 9 19920621 missense possibly damaging 0.87
R5503:Olfr77 UTSW 9 19920379 missense probably benign 0.36
R5760:Olfr77 UTSW 9 19920754 missense probably benign 0.00
R5778:Olfr77 UTSW 9 19921041 missense probably benign 0.20
R5930:Olfr77 UTSW 9 19920910 missense probably damaging 0.99
R6012:Olfr77 UTSW 9 19920941 missense probably damaging 0.99
R7269:Olfr77 UTSW 9 19920335 missense possibly damaging 0.95
R7977:Olfr77 UTSW 9 19920314 missense possibly damaging 0.48
R7987:Olfr77 UTSW 9 19920314 missense possibly damaging 0.48
R8174:Olfr77 UTSW 9 19920724 missense probably damaging 1.00
Z1088:Olfr77 UTSW 9 19920712 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgattctctgattccacttttacac -3'
Posted On 2014-05-23