Mutagenetix > Incidental Mutations

Incidental Mutation 'R1761:Scg3'

192782

Institutional Source

Beutler Lab

Gene Symbol

Scg3

Ensembl Gene

ENSMUSG00000032181

Gene Name

secretogranin III

Synonyms

SgIII, Chgd, 1B1075

MMRRC Submission

039793-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75643189-75684056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75676758 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 154 (I154F)

Ref Sequence

ENSEMBL: ENSMUSP00000149561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034699
AA Change: I154F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181
AA Change: I154F

Domain	Start	End	E-Value	Type
Pfam:SGIII	20	471	1.3e-215	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213324
AA Change: I154F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000215603

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,507,223	P109L	probably damaging	Het
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Acan	T	A	7: 79,094,085	Y621*	probably null	Het
Aig1	T	C	10: 13,690,584	Y152C	probably damaging	Het
Arhgap33	C	T	7: 30,533,063		probably null	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Cbx5	T	C	15: 103,213,180	D10G	possibly damaging	Het
Ccdc191	A	G	16: 43,943,510	I445V	probably benign	Het
Cdk4	T	A	10: 127,064,677		probably benign	Het
Chil6	A	G	3: 106,394,338	F149L	probably damaging	Het
Cntn5	T	C	9: 10,172,054	T42A	probably benign	Het
Cpn2	A	T	16: 30,260,196	I229N	probably damaging	Het
Cpne8	A	G	15: 90,648,618	V62A	probably damaging	Het
Cr2	A	G	1: 195,155,123		probably null	Het
Crnn	A	T	3: 93,148,651	H248L	probably benign	Het
Csn1s1	A	G	5: 87,679,035	S254G	probably benign	Het
Cubn	A	G	2: 13,489,317		probably null	Het
Dnah8	A	G	17: 30,779,916	N3525S	probably damaging	Het
Dpp3	A	G	19: 4,921,149	L220P	probably benign	Het
Fam110a	T	C	2: 151,970,205	E215G	probably benign	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Fat4	T	C	3: 38,887,489	V177A	possibly damaging	Het
Fzd8	C	T	18: 9,213,643	R242C	probably damaging	Het
Gimap5	A	T	6: 48,753,261	Q255L	probably damaging	Het
Gm13083	T	C	4: 143,615,868	Y182H	probably benign	Het
Gm4787	A	G	12: 81,377,176	L736S	probably benign	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Gpr179	A	C	11: 97,335,106	S2074R	probably benign	Het
Hddc2	G	T	10: 31,326,139	D161Y	probably damaging	Het
Hlcs	T	C	16: 94,268,007	D265G	probably benign	Het
Hspg2	A	T	4: 137,514,673	I573F	possibly damaging	Het
Il1b	T	C	2: 129,365,181	K220E	probably damaging	Het
Il5	T	C	11: 53,723,730	I66T	probably damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Lmf2	A	G	15: 89,352,713	V442A	possibly damaging	Het
Mcm2	T	C	6: 88,889,788	I412M	possibly damaging	Het
Mlkl	T	A	8: 111,333,723	L18F	possibly damaging	Het
Mug2	C	A	6: 122,074,705	H949N	probably benign	Het
Nf1	T	C	11: 79,384,265	F51L	probably damaging	Het
Olfr1049	T	G	2: 86,255,039	Y218S	probably damaging	Het
Olfr592	T	G	7: 103,187,118	C172W	probably damaging	Het
Olfr77	A	T	9: 19,921,149	*313C	probably null	Het
P3h2	T	C	16: 25,985,050	E322G	probably damaging	Het
Psmg2	CTTCAGTT	CTTCAGTTCAGTT	18: 67,646,025		probably null	Het
Ptdss1	T	C	13: 66,956,412	V116A	possibly damaging	Het
Ranbp2	T	C	10: 58,485,741	V2620A	probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Scgn	A	T	13: 23,959,706	F225Y	probably damaging	Het
Sec61b	T	C	4: 47,480,137	C58R	possibly damaging	Het
Slc25a46	G	T	18: 31,607,262	Q96K	possibly damaging	Het
Sptb	A	G	12: 76,612,608	F1173L	probably damaging	Het
Srcap	T	A	7: 127,534,845	C893S	probably damaging	Het
Tet3	T	C	6: 83,403,659	E509G	probably damaging	Het
Timm10b	C	T	7: 105,683,708	R897*	probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Tti1	T	C	2: 158,007,697	I541V	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Vgll3	A	T	16: 65,839,728	D310V	probably damaging	Het
Vmac	A	G	17: 56,715,788	L74P	probably damaging	Het
Zbtb1	A	T	12: 76,385,821	K194*	probably null	Het
Zfp429	A	G	13: 67,396,076	M76T	probably benign	Het
Zfp808	T	A	13: 62,171,646	C230S	possibly damaging	Het
Zfp980	A	G	4: 145,702,042	Y447C	probably damaging	Het
Zfp985	A	G	4: 147,584,045	T457A	probably benign	Het

Other mutations in Scg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Scg3	APN	9	75663237	missense	probably damaging	1.00
IGL02221:Scg3	APN	9	75683657	missense	probably damaging	0.99
IGL03391:Scg3	APN	9	75661251	critical splice donor site	probably null
R0137:Scg3	UTSW	9	75663180	unclassified	probably benign
R0366:Scg3	UTSW	9	75675338	splice site	probably benign
R0650:Scg3	UTSW	9	75669335	missense	probably damaging	1.00
R0654:Scg3	UTSW	9	75665735	missense	probably damaging	1.00
R0666:Scg3	UTSW	9	75643940	nonsense	probably null
R0827:Scg3	UTSW	9	75683697	missense	possibly damaging	0.81
R1317:Scg3	UTSW	9	75669340	missense	probably damaging	1.00
R1553:Scg3	UTSW	9	75669304	missense	probably null	1.00
R1751:Scg3	UTSW	9	75669340	missense	probably damaging	1.00
R1850:Scg3	UTSW	9	75682167	missense	possibly damaging	0.56
R2059:Scg3	UTSW	9	75665716	missense	probably damaging	1.00
R2137:Scg3	UTSW	9	75676810	missense	probably damaging	0.96
R2384:Scg3	UTSW	9	75665726	missense	probably damaging	1.00
R3870:Scg3	UTSW	9	75675499	splice site	probably benign
R4260:Scg3	UTSW	9	75651697	missense	probably damaging	1.00
R5371:Scg3	UTSW	9	75661301	missense	probably damaging	1.00
R5417:Scg3	UTSW	9	75669256	missense	probably benign	0.02
R6013:Scg3	UTSW	9	75676808	missense	probably damaging	1.00
R7052:Scg3	UTSW	9	75661382	nonsense	probably null
R7202:Scg3	UTSW	9	75683710	missense	probably benign	0.06
R7211:Scg3	UTSW	9	75682084	missense	probably benign	0.00
R7471:Scg3	UTSW	9	75682092	missense	probably damaging	1.00
R7490:Scg3	UTSW	9	75669277	missense	possibly damaging	0.94
R7651:Scg3	UTSW	9	75682050	missense	probably benign	0.03
R7904:Scg3	UTSW	9	75643867	missense	probably damaging	1.00
Z1176:Scg3	UTSW	9	75669316	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- AGCATCGGAAGCGTCCCATTAC -3'
(R):5'- GCGTCTCTGCAACGATTTGCATATTG -3'

Sequencing Primer
(F):5'- CAGGCCAAGATTCAGCAGTT -3'
(R):5'- ccaagttccagtccagcc -3'

Posted On

2014-05-23