Incidental Mutation 'R1761:Cdk4'
ID192787
Institutional Source Beutler Lab
Gene Symbol Cdk4
Ensembl Gene ENSMUSG00000006728
Gene Namecyclin-dependent kinase 4
SynonymsCrk3, p34/cdk4
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127063534-127067920 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 127064677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably damaging
Transcript: ENSMUST00000006911
AA Change: L104Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: L104Q

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040307
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060991
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably damaging
Transcript: ENSMUST00000125682
AA Change: L104Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: L104Q

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133115
AA Change: L104Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: L104Q

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Cdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Cdk4 APN 10 127064297 missense probably damaging 1.00
IGL01326:Cdk4 APN 10 127064623 missense possibly damaging 0.95
R0140:Cdk4 UTSW 10 127064345 missense probably damaging 1.00
R0799:Cdk4 UTSW 10 127064994 missense probably damaging 0.98
R1437:Cdk4 UTSW 10 127064689 missense probably damaging 1.00
R1575:Cdk4 UTSW 10 127064651 missense probably damaging 1.00
R1656:Cdk4 UTSW 10 127064980 missense probably benign 0.00
R2567:Cdk4 UTSW 10 127064276 missense probably benign 0.01
R4679:Cdk4 UTSW 10 127064911 missense possibly damaging 0.93
R4790:Cdk4 UTSW 10 127064701 missense probably damaging 1.00
R4897:Cdk4 UTSW 10 127064575 intron probably benign
R4946:Cdk4 UTSW 10 127064890 splice site probably null
R5755:Cdk4 UTSW 10 127064722 critical splice donor site probably null
R6515:Cdk4 UTSW 10 127066183 missense probably null 0.06
R6868:Cdk4 UTSW 10 127065001 missense probably benign 0.43
R7488:Cdk4 UTSW 10 127064237 start codon destroyed probably null 0.26
R7748:Cdk4 UTSW 10 127064429 missense possibly damaging 0.78
R8956:Cdk4 UTSW 10 127064677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGTTCCTAATGGAGGAGCAGC -3'
(R):5'- TTCAGGTCCCGGTGAACAATGCAG -3'

Sequencing Primer
(F):5'- GGCCTTTGAACATCCCAATG -3'
(R):5'- CGCTTAGAAACTGACGCATTAG -3'
Posted On2014-05-23