Mutagenetix > Incidental Mutations

Incidental Mutation 'R1761:Gpr179'

192790

Institutional Source

Beutler Lab

Gene Symbol

Gpr179

Ensembl Gene

ENSMUSG00000070337

Gene Name

G protein-coupled receptor 179

Synonyms

5330439C02Rik

MMRRC Submission

039793-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R1761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97332109-97352077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 97335106 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 2074 (S2074R)

Ref Sequence

ENSEMBL: ENSMUSP00000091474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093942]

Predicted Effect

probably benign
Transcript: ENSMUST00000093942
AA Change: S2074R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: S2074R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	41	N/A	INTRINSIC
EGF	281	357	1.91e1	SMART
Pfam:7tm_3	391	633	3.2e-40	PFAM
low complexity region	735	759	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	896	916	N/A	INTRINSIC
low complexity region	959	988	N/A	INTRINSIC
low complexity region	1107	1125	N/A	INTRINSIC
internal_repeat_2	1156	1467	1.99e-12	PROSPERO
internal_repeat_1	1235	1674	2.85e-27	PROSPERO
internal_repeat_2	1569	1879	1.99e-12	PROSPERO
internal_repeat_1	1756	2284	2.85e-27	PROSPERO

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,507,223	P109L	probably damaging	Het
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Acan	T	A	7: 79,094,085	Y621*	probably null	Het
Aig1	T	C	10: 13,690,584	Y152C	probably damaging	Het
Arhgap33	C	T	7: 30,533,063		probably null	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Cbx5	T	C	15: 103,213,180	D10G	possibly damaging	Het
Ccdc191	A	G	16: 43,943,510	I445V	probably benign	Het
Cdk4	T	A	10: 127,064,677		probably null	Het
Chil6	A	G	3: 106,394,338	F149L	probably damaging	Het
Cntn5	T	C	9: 10,172,054	T42A	probably benign	Het
Cpn2	A	T	16: 30,260,196	I229N	probably damaging	Het
Cpne8	A	G	15: 90,648,618	V62A	probably damaging	Het
Cr2	A	G	1: 195,155,123		probably null	Het
Crnn	A	T	3: 93,148,651	H248L	probably benign	Het
Csn1s1	A	G	5: 87,679,035	S254G	probably benign	Het
Cubn	A	G	2: 13,489,317		probably null	Het
Dnah8	A	G	17: 30,779,916	N3525S	probably damaging	Het
Dpp3	A	G	19: 4,921,149	L220P	probably benign	Het
Fam110a	T	C	2: 151,970,205	E215G	probably benign	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Fat4	T	C	3: 38,887,489	V177A	possibly damaging	Het
Fzd8	C	T	18: 9,213,643	R242C	probably damaging	Het
Gimap5	A	T	6: 48,753,261	Q255L	probably damaging	Het
Gm13083	T	C	4: 143,615,868	Y182H	probably benign	Het
Gm4787	A	G	12: 81,377,176	L736S	probably benign	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Hddc2	G	T	10: 31,326,139	D161Y	probably damaging	Het
Hlcs	T	C	16: 94,268,007	D265G	probably benign	Het
Hspg2	A	T	4: 137,514,673	I573F	possibly damaging	Het
Il1b	T	C	2: 129,365,181	K220E	probably damaging	Het
Il5	T	C	11: 53,723,730	I66T	probably damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Lmf2	A	G	15: 89,352,713	V442A	possibly damaging	Het
Mcm2	T	C	6: 88,889,788	I412M	possibly damaging	Het
Mlkl	T	A	8: 111,333,723	L18F	possibly damaging	Het
Mug2	C	A	6: 122,074,705	H949N	probably benign	Het
Nf1	T	C	11: 79,384,265	F51L	probably damaging	Het
Olfr1049	T	G	2: 86,255,039	Y218S	probably damaging	Het
Olfr592	T	G	7: 103,187,118	C172W	probably damaging	Het
Olfr77	A	T	9: 19,921,149	*313C	probably null	Het
P3h2	T	C	16: 25,985,050	E322G	probably damaging	Het
Psmg2	CTTCAGTT	CTTCAGTTCAGTT	18: 67,646,025		probably null	Het
Ptdss1	T	C	13: 66,956,412	V116A	possibly damaging	Het
Ranbp2	T	C	10: 58,485,741	V2620A	probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Scg3	T	A	9: 75,676,758	I154F	probably damaging	Het
Scgn	A	T	13: 23,959,706	F225Y	probably damaging	Het
Sec61b	T	C	4: 47,480,137	C58R	possibly damaging	Het
Slc25a46	G	T	18: 31,607,262	Q96K	possibly damaging	Het
Sptb	A	G	12: 76,612,608	F1173L	probably damaging	Het
Srcap	T	A	7: 127,534,845	C893S	probably damaging	Het
Tet3	T	C	6: 83,403,659	E509G	probably damaging	Het
Timm10b	C	T	7: 105,683,708	R897*	probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Tti1	T	C	2: 158,007,697	I541V	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Vgll3	A	T	16: 65,839,728	D310V	probably damaging	Het
Vmac	A	G	17: 56,715,788	L74P	probably damaging	Het
Zbtb1	A	T	12: 76,385,821	K194*	probably null	Het
Zfp429	A	G	13: 67,396,076	M76T	probably benign	Het
Zfp808	T	A	13: 62,171,646	C230S	possibly damaging	Het
Zfp980	A	G	4: 145,702,042	Y447C	probably damaging	Het
Zfp985	A	G	4: 147,584,045	T457A	probably benign	Het

Other mutations in Gpr179

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Gpr179	APN	11	97337801	missense	probably damaging	0.99
IGL01152:Gpr179	APN	11	97337411	missense	probably benign	0.08
IGL01402:Gpr179	APN	11	97338186	nonsense	probably null
IGL01404:Gpr179	APN	11	97338186	nonsense	probably null
IGL01773:Gpr179	APN	11	97341366	missense	probably benign	0.05
IGL02682:Gpr179	APN	11	97351865	missense	probably benign
IGL02728:Gpr179	APN	11	97337900	missense	probably damaging	0.99
IGL03243:Gpr179	APN	11	97351475	missense	probably benign	0.02
IGL03272:Gpr179	APN	11	97336593	missense	possibly damaging	0.89
IGL03347:Gpr179	APN	11	97351838	missense	probably damaging	1.00
IGL03355:Gpr179	APN	11	97337608	missense	possibly damaging	0.57
PIT4280001:Gpr179	UTSW	11	97344115	missense	probably damaging	1.00
PIT4366001:Gpr179	UTSW	11	97336851	missense	probably benign
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0080:Gpr179	UTSW	11	97351469	missense	probably benign	0.08
R0255:Gpr179	UTSW	11	97336066	missense	probably benign	0.24
R0412:Gpr179	UTSW	11	97338807	missense	probably damaging	1.00
R0481:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R0612:Gpr179	UTSW	11	97338438	missense	possibly damaging	0.86
R0786:Gpr179	UTSW	11	97343274	missense	probably damaging	1.00
R1753:Gpr179	UTSW	11	97346578	missense	probably damaging	1.00
R1796:Gpr179	UTSW	11	97336556	missense	possibly damaging	0.86
R1969:Gpr179	UTSW	11	97337958	missense	probably benign
R2240:Gpr179	UTSW	11	97351733	missense	probably damaging	1.00
R3855:Gpr179	UTSW	11	97341434	missense	probably damaging	1.00
R3913:Gpr179	UTSW	11	97334765	missense	probably benign	0.01
R4484:Gpr179	UTSW	11	97335711	missense	probably benign	0.28
R4806:Gpr179	UTSW	11	97349784	missense	possibly damaging	0.55
R4816:Gpr179	UTSW	11	97339248	missense	probably damaging	0.99
R4906:Gpr179	UTSW	11	97346661	missense	possibly damaging	0.87
R4945:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R5191:Gpr179	UTSW	11	97338149	missense	possibly damaging	0.76
R5273:Gpr179	UTSW	11	97347430	missense	probably damaging	1.00
R5317:Gpr179	UTSW	11	97337845	missense	probably damaging	1.00
R5459:Gpr179	UTSW	11	97336657	missense	probably benign	0.00
R5507:Gpr179	UTSW	11	97338330	missense	probably damaging	1.00
R5523:Gpr179	UTSW	11	97336782	missense	probably benign	0.37
R5536:Gpr179	UTSW	11	97343815	missense	probably damaging	1.00
R5591:Gpr179	UTSW	11	97345755	missense	probably benign	0.17
R5679:Gpr179	UTSW	11	97336745	missense	probably benign	0.20
R5738:Gpr179	UTSW	11	97351406	missense	probably damaging	1.00
R5829:Gpr179	UTSW	11	97335698	missense	probably benign	0.11
R5836:Gpr179	UTSW	11	97339056	missense	probably benign	0.03
R6007:Gpr179	UTSW	11	97335802	nonsense	probably null
R6047:Gpr179	UTSW	11	97338416	missense	probably damaging	1.00
R6339:Gpr179	UTSW	11	97344176	missense	probably damaging	1.00
R6383:Gpr179	UTSW	11	97337147	missense	possibly damaging	0.88
R6674:Gpr179	UTSW	11	97347405	critical splice donor site	probably null
R6712:Gpr179	UTSW	11	97336167	missense	possibly damaging	0.94
R6835:Gpr179	UTSW	11	97347467	missense	probably damaging	1.00
R6980:Gpr179	UTSW	11	97334858	missense	probably benign	0.38
R7044:Gpr179	UTSW	11	97349790	missense	probably benign	0.19
R7121:Gpr179	UTSW	11	97334730	missense	probably benign	0.00
R7307:Gpr179	UTSW	11	97338846	missense	probably benign	0.36
R7406:Gpr179	UTSW	11	97351594	missense	probably damaging	0.99
R7467:Gpr179	UTSW	11	97335289	missense	probably benign	0.02
R7477:Gpr179	UTSW	11	97335839	missense	possibly damaging	0.87
R7725:Gpr179	UTSW	11	97351292	missense	probably damaging	1.00
R8028:Gpr179	UTSW	11	97337801	missense	probably damaging	0.99
R8165:Gpr179	UTSW	11	97351538	missense	probably benign	0.12
R8262:Gpr179	UTSW	11	97336157	missense	probably benign	0.00
X0065:Gpr179	UTSW	11	97347438	missense	probably benign	0.08
Z1176:Gpr179	UTSW	11	97336648	missense	probably benign	0.05
Z1177:Gpr179	UTSW	11	97351239	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCTTGCTCCATGAAGACCAAC -3'
(R):5'- CCTGAAACACGAGATCACGAAGGTG -3'

Sequencing Primer
(F):5'- TCTGCTGCCTTCAAGAGATG -3'
(R):5'- CACAGACCAGCAACTTTGGG -3'

Posted On

2014-05-23