Incidental Mutation 'R1761:Fam20a'
ID 192791
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name FAM20A, golgi associated secretory pathway pseudokinase
Synonyms
MMRRC Submission 039793-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1761 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 109563752-109613989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109568664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 287 (N287K)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably damaging
Transcript: ENSMUST00000020938
AA Change: N287K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: N287K

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect probably damaging
Transcript: ENSMUST00000155559
AA Change: N287K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: N287K

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Meta Mutation Damage Score 0.6913 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,488,672 (GRCm39) H1268Y possibly damaging Het
Acan T A 7: 78,743,833 (GRCm39) Y621* probably null Het
Aig1 T C 10: 13,566,328 (GRCm39) Y152C probably damaging Het
Arhgap33 C T 7: 30,232,488 (GRCm39) probably null Het
Bcl6 G T 16: 23,796,292 (GRCm39) A45D probably damaging Het
Cbx5 T C 15: 103,121,607 (GRCm39) D10G possibly damaging Het
Ccdc191 A G 16: 43,763,873 (GRCm39) I445V probably benign Het
Cdk4 T A 10: 126,900,546 (GRCm39) probably benign Het
Chil6 A G 3: 106,301,654 (GRCm39) F149L probably damaging Het
Cntn5 T C 9: 10,172,059 (GRCm39) T42A probably benign Het
Cpn2 A T 16: 30,079,014 (GRCm39) I229N probably damaging Het
Cpne8 A G 15: 90,532,821 (GRCm39) V62A probably damaging Het
Cr2 A G 1: 194,837,431 (GRCm39) probably null Het
Crnn A T 3: 93,055,958 (GRCm39) H248L probably benign Het
Csn1s1 A G 5: 87,826,894 (GRCm39) S254G probably benign Het
Cubn A G 2: 13,494,128 (GRCm39) probably null Het
Dnah8 A G 17: 30,998,890 (GRCm39) N3525S probably damaging Het
Dpp3 A G 19: 4,971,177 (GRCm39) L220P probably benign Het
Fam110a T C 2: 151,812,125 (GRCm39) E215G probably benign Het
Fat4 T C 3: 38,941,638 (GRCm39) V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 (GRCm39) R242C probably damaging Het
Gimap5 A T 6: 48,730,195 (GRCm39) Q255L probably damaging Het
Gm4787 A G 12: 81,423,950 (GRCm39) L736S probably benign Het
Gmeb1 G A 4: 131,962,198 (GRCm39) Q154* probably null Het
Gpr156 T C 16: 37,807,929 (GRCm39) L192P probably damaging Het
Gpr179 A C 11: 97,225,932 (GRCm39) S2074R probably benign Het
Hddc2 G T 10: 31,202,135 (GRCm39) D161Y probably damaging Het
Hlcs T C 16: 94,068,866 (GRCm39) D265G probably benign Het
Hspg2 A T 4: 137,241,984 (GRCm39) I573F possibly damaging Het
Il1b T C 2: 129,207,101 (GRCm39) K220E probably damaging Het
Il5 T C 11: 53,614,557 (GRCm39) I66T probably damaging Het
Irf6 G A 1: 192,851,609 (GRCm39) R400H probably damaging Het
Klra1 A T 6: 130,349,836 (GRCm39) Y201N probably damaging Het
Lmf2 A G 15: 89,236,916 (GRCm39) V442A possibly damaging Het
Mcm2 T C 6: 88,866,770 (GRCm39) I412M possibly damaging Het
Mlkl T A 8: 112,060,355 (GRCm39) L18F possibly damaging Het
Mug2 C A 6: 122,051,664 (GRCm39) H949N probably benign Het
Nf1 T C 11: 79,275,091 (GRCm39) F51L probably damaging Het
Or52j3 T G 7: 102,836,325 (GRCm39) C172W probably damaging Het
Or7d10 A T 9: 19,832,445 (GRCm39) *313C probably null Het
Or8k18 T G 2: 86,085,383 (GRCm39) Y218S probably damaging Het
P3h2 T C 16: 25,803,800 (GRCm39) E322G probably damaging Het
Pramel21 T C 4: 143,342,438 (GRCm39) Y182H probably benign Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,779,095 (GRCm39) probably null Het
Ptdss1 T C 13: 67,104,476 (GRCm39) V116A possibly damaging Het
Ranbp2 T C 10: 58,321,563 (GRCm39) V2620A probably benign Het
Robo2 A G 16: 73,831,912 (GRCm39) V256A probably damaging Het
Scg3 T A 9: 75,584,040 (GRCm39) I154F probably damaging Het
Scgn A T 13: 24,143,689 (GRCm39) F225Y probably damaging Het
Sec61b T C 4: 47,480,137 (GRCm39) C58R possibly damaging Het
Slc25a46 G T 18: 31,740,315 (GRCm39) Q96K possibly damaging Het
Spmip6 G A 4: 41,507,223 (GRCm39) P109L probably damaging Het
Sptb A G 12: 76,659,382 (GRCm39) F1173L probably damaging Het
Srcap T A 7: 127,134,017 (GRCm39) C893S probably damaging Het
Tet3 T C 6: 83,380,641 (GRCm39) E509G probably damaging Het
Timm10b C T 7: 105,332,915 (GRCm39) R897* probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tom1 T C 8: 75,778,179 (GRCm39) V87A probably benign Het
Tti1 T C 2: 157,849,617 (GRCm39) I541V probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubb1 A G 2: 174,298,689 (GRCm39) S124G probably benign Het
Vgll3 A T 16: 65,636,614 (GRCm39) D310V probably damaging Het
Vmac A G 17: 57,022,788 (GRCm39) L74P probably damaging Het
Zbtb1 A T 12: 76,432,595 (GRCm39) K194* probably null Het
Zfp429 A G 13: 67,544,195 (GRCm39) M76T probably benign Het
Zfp808 T A 13: 62,319,460 (GRCm39) C230S possibly damaging Het
Zfp980 A G 4: 145,428,612 (GRCm39) Y447C probably damaging Het
Zfp985 A G 4: 147,668,502 (GRCm39) T457A probably benign Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109,568,588 (GRCm39) splice site probably benign
IGL01296:Fam20a APN 11 109,576,177 (GRCm39) missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109,569,284 (GRCm39) splice site probably benign
IGL01322:Fam20a APN 11 109,573,738 (GRCm39) missense probably damaging 1.00
IGL02086:Fam20a APN 11 109,564,239 (GRCm39) missense probably benign 0.00
IGL02563:Fam20a APN 11 109,568,620 (GRCm39) missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109,565,953 (GRCm39) missense probably damaging 0.99
IGL02893:Fam20a APN 11 109,612,414 (GRCm39) missense probably benign 0.00
Infamy UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
snide UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
ungainly UTSW 11 109,573,696 (GRCm39) nonsense probably null
P0026:Fam20a UTSW 11 109,566,667 (GRCm39) critical splice donor site probably null
R0726:Fam20a UTSW 11 109,568,020 (GRCm39) missense probably damaging 1.00
R1317:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1751:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1889:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1895:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1971:Fam20a UTSW 11 109,576,237 (GRCm39) missense probably damaging 1.00
R2192:Fam20a UTSW 11 109,565,449 (GRCm39) missense probably benign 0.13
R3745:Fam20a UTSW 11 109,568,616 (GRCm39) missense probably benign 0.17
R4684:Fam20a UTSW 11 109,612,513 (GRCm39) missense unknown
R4835:Fam20a UTSW 11 109,564,389 (GRCm39) missense probably benign 0.40
R5045:Fam20a UTSW 11 109,568,711 (GRCm39) missense probably benign 0.38
R5161:Fam20a UTSW 11 109,564,196 (GRCm39) missense probably benign 0.00
R5715:Fam20a UTSW 11 109,569,257 (GRCm39) missense probably damaging 1.00
R5817:Fam20a UTSW 11 109,564,244 (GRCm39) missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109,566,795 (GRCm39) intron probably benign
R6162:Fam20a UTSW 11 109,573,696 (GRCm39) nonsense probably null
R6312:Fam20a UTSW 11 109,565,456 (GRCm39) missense probably damaging 1.00
R7231:Fam20a UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109,565,454 (GRCm39) nonsense probably null
R7366:Fam20a UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109,566,754 (GRCm39) nonsense probably null
R9751:Fam20a UTSW 11 109,565,992 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGACCACTGTTGGACCTAC -3'
(R):5'- TGCTACCCAGACCTTTGGAGAGAAC -3'

Sequencing Primer
(F):5'- ACCTACCAGTGGGCATGATG -3'
(R):5'- tcctccagtctttgtttgcc -3'
Posted On 2014-05-23