Mutagenetix > Incidental Mutations

Incidental Mutation 'R1761:Sptb'

192793

Institutional Source

Beutler Lab

Gene Symbol

Sptb

Ensembl Gene

ENSMUSG00000021061

Gene Name

spectrin beta, erythrocytic

Synonyms

LOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1

MMRRC Submission

039793-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R1761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76580488-76710547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76612608 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1173 (F1173L)

Ref Sequence

ENSEMBL: ENSMUSP00000021458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021458
AA Change: F1173L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: F1173L

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166101
AA Change: F1173L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: F1173L

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.87e-11	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2117	1.16e-9	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,507,223	P109L	probably damaging	Het
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Acan	T	A	7: 79,094,085	Y621*	probably null	Het
Aig1	T	C	10: 13,690,584	Y152C	probably damaging	Het
Arhgap33	C	T	7: 30,533,063		probably null	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Cbx5	T	C	15: 103,213,180	D10G	possibly damaging	Het
Ccdc191	A	G	16: 43,943,510	I445V	probably benign	Het
Cdk4	T	A	10: 127,064,677		probably null	Het
Chil6	A	G	3: 106,394,338	F149L	probably damaging	Het
Cntn5	T	C	9: 10,172,054	T42A	probably benign	Het
Cpn2	A	T	16: 30,260,196	I229N	probably damaging	Het
Cpne8	A	G	15: 90,648,618	V62A	probably damaging	Het
Cr2	A	G	1: 195,155,123		probably null	Het
Crnn	A	T	3: 93,148,651	H248L	probably benign	Het
Csn1s1	A	G	5: 87,679,035	S254G	probably benign	Het
Cubn	A	G	2: 13,489,317		probably null	Het
Dnah8	A	G	17: 30,779,916	N3525S	probably damaging	Het
Dpp3	A	G	19: 4,921,149	L220P	probably benign	Het
Fam110a	T	C	2: 151,970,205	E215G	probably benign	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Fat4	T	C	3: 38,887,489	V177A	possibly damaging	Het
Fzd8	C	T	18: 9,213,643	R242C	probably damaging	Het
Gimap5	A	T	6: 48,753,261	Q255L	probably damaging	Het
Gm13083	T	C	4: 143,615,868	Y182H	probably benign	Het
Gm4787	A	G	12: 81,377,176	L736S	probably benign	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Gpr179	A	C	11: 97,335,106	S2074R	probably benign	Het
Hddc2	G	T	10: 31,326,139	D161Y	probably damaging	Het
Hlcs	T	C	16: 94,268,007	D265G	probably benign	Het
Hspg2	A	T	4: 137,514,673	I573F	possibly damaging	Het
Il1b	T	C	2: 129,365,181	K220E	probably damaging	Het
Il5	T	C	11: 53,723,730	I66T	probably damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Lmf2	A	G	15: 89,352,713	V442A	possibly damaging	Het
Mcm2	T	C	6: 88,889,788	I412M	possibly damaging	Het
Mlkl	T	A	8: 111,333,723	L18F	possibly damaging	Het
Mug2	C	A	6: 122,074,705	H949N	probably benign	Het
Nf1	T	C	11: 79,384,265	F51L	probably damaging	Het
Olfr1049	T	G	2: 86,255,039	Y218S	probably damaging	Het
Olfr592	T	G	7: 103,187,118	C172W	probably damaging	Het
Olfr77	A	T	9: 19,921,149	*313C	probably null	Het
P3h2	T	C	16: 25,985,050	E322G	probably damaging	Het
Psmg2	CTTCAGTT	CTTCAGTTCAGTT	18: 67,646,025		probably null	Het
Ptdss1	T	C	13: 66,956,412	V116A	possibly damaging	Het
Ranbp2	T	C	10: 58,485,741	V2620A	probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Scg3	T	A	9: 75,676,758	I154F	probably damaging	Het
Scgn	A	T	13: 23,959,706	F225Y	probably damaging	Het
Sec61b	T	C	4: 47,480,137	C58R	possibly damaging	Het
Slc25a46	G	T	18: 31,607,262	Q96K	possibly damaging	Het
Srcap	T	A	7: 127,534,845	C893S	probably damaging	Het
Tet3	T	C	6: 83,403,659	E509G	probably damaging	Het
Timm10b	C	T	7: 105,683,708	R897*	probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Tti1	T	C	2: 158,007,697	I541V	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Vgll3	A	T	16: 65,839,728	D310V	probably damaging	Het
Vmac	A	G	17: 56,715,788	L74P	probably damaging	Het
Zbtb1	A	T	12: 76,385,821	K194*	probably null	Het
Zfp429	A	G	13: 67,396,076	M76T	probably benign	Het
Zfp808	T	A	13: 62,171,646	C230S	possibly damaging	Het
Zfp980	A	G	4: 145,702,042	Y447C	probably damaging	Het
Zfp985	A	G	4: 147,584,045	T457A	probably benign	Het

Other mutations in Sptb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Sptb	APN	12	76621331	missense	probably benign	0.00
IGL00160:Sptb	APN	12	76623169	missense	probably damaging	1.00
IGL00229:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL00820:Sptb	APN	12	76632477	missense	probably damaging	1.00
IGL01309:Sptb	APN	12	76587463	missense	probably benign	0.16
IGL01408:Sptb	APN	12	76613147	missense	possibly damaging	0.93
IGL01450:Sptb	APN	12	76624240	missense	possibly damaging	0.89
IGL01455:Sptb	APN	12	76612912	missense	probably damaging	1.00
IGL01457:Sptb	APN	12	76612555	splice site	probably benign
IGL01680:Sptb	APN	12	76630682	missense	probably damaging	1.00
IGL02070:Sptb	APN	12	76605539	missense	possibly damaging	0.82
IGL02346:Sptb	APN	12	76621014	missense	probably damaging	1.00
IGL02452:Sptb	APN	12	76609036	critical splice donor site	probably null
IGL02515:Sptb	APN	12	76606487	missense	possibly damaging	0.51
IGL02545:Sptb	APN	12	76607980	critical splice donor site	probably null
IGL02644:Sptb	APN	12	76605617	missense	probably damaging	1.00
IGL02878:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL03007:Sptb	APN	12	76621341	missense	probably damaging	1.00
IGL03220:Sptb	APN	12	76612910	missense	probably benign	0.06
IGL03343:Sptb	APN	12	76583556	unclassified	probably benign
IGL03098:Sptb	UTSW	12	76621499	missense	probably damaging	1.00
PIT4472001:Sptb	UTSW	12	76620686	missense	probably damaging	1.00
R0047:Sptb	UTSW	12	76622950	missense	probably damaging	0.99
R0365:Sptb	UTSW	12	76600383	missense	probably benign	0.12
R0373:Sptb	UTSW	12	76621371	missense	probably benign	0.03
R0704:Sptb	UTSW	12	76583594	missense	probably damaging	0.99
R1005:Sptb	UTSW	12	76601859	critical splice donor site	probably null
R1109:Sptb	UTSW	12	76603603	missense	probably damaging	1.00
R1264:Sptb	UTSW	12	76612607	missense	probably damaging	1.00
R1358:Sptb	UTSW	12	76621321	frame shift	probably null
R1358:Sptb	UTSW	12	76621326	missense	probably damaging	1.00
R1459:Sptb	UTSW	12	76611883	missense	probably benign	0.01
R1518:Sptb	UTSW	12	76604024	missense	possibly damaging	0.95
R1628:Sptb	UTSW	12	76583848	missense	probably damaging	1.00
R1668:Sptb	UTSW	12	76621169	missense	probably benign
R1677:Sptb	UTSW	12	76629649	missense	probably damaging	1.00
R1687:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R1695:Sptb	UTSW	12	76620867	missense	probably benign	0.10
R1708:Sptb	UTSW	12	76612574	missense	probably damaging	1.00
R1925:Sptb	UTSW	12	76622253	missense	probably damaging	1.00
R2011:Sptb	UTSW	12	76632472	missense	possibly damaging	0.95
R2373:Sptb	UTSW	12	76621161	missense	probably damaging	1.00
R2517:Sptb	UTSW	12	76649869	missense	possibly damaging	0.55
R2918:Sptb	UTSW	12	76598758	missense	probably damaging	0.97
R2961:Sptb	UTSW	12	76603582	missense	probably benign	0.19
R3409:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3410:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3411:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3744:Sptb	UTSW	12	76600400	missense	probably benign
R4112:Sptb	UTSW	12	76597779	missense	probably damaging	0.99
R4177:Sptb	UTSW	12	76613179	missense	probably benign	0.25
R4194:Sptb	UTSW	12	76613010	missense	probably benign	0.44
R4301:Sptb	UTSW	12	76612697	missense	probably damaging	1.00
R4555:Sptb	UTSW	12	76612851	missense	probably benign	0.03
R4619:Sptb	UTSW	12	76583807	nonsense	probably null
R4620:Sptb	UTSW	12	76583807	nonsense	probably null
R4625:Sptb	UTSW	12	76587326	splice site	probably null
R4728:Sptb	UTSW	12	76583379	missense	probably benign	0.00
R4751:Sptb	UTSW	12	76627110	missense	probably benign	0.07
R4810:Sptb	UTSW	12	76623197	nonsense	probably null
R4888:Sptb	UTSW	12	76609037	missense	probably benign	0.00
R4894:Sptb	UTSW	12	76624994	critical splice donor site	probably null
R5114:Sptb	UTSW	12	76609278	missense	probably damaging	1.00
R5191:Sptb	UTSW	12	76612834	missense	probably benign	0.12
R5479:Sptb	UTSW	12	76599851	missense	probably benign	0.04
R5646:Sptb	UTSW	12	76587441	missense	probably benign
R5725:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5727:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5797:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R5874:Sptb	UTSW	12	76598727	missense	possibly damaging	0.91
R5952:Sptb	UTSW	12	76632384	missense	probably benign	0.02
R5956:Sptb	UTSW	12	76604168	missense	probably benign
R6298:Sptb	UTSW	12	76620654	critical splice donor site	probably null
R6470:Sptb	UTSW	12	76612829	missense	probably damaging	1.00
R6477:Sptb	UTSW	12	76606392	missense	probably damaging	1.00
R6736:Sptb	UTSW	12	76613180	missense	possibly damaging	0.49
R6854:Sptb	UTSW	12	76603480	missense	probably damaging	1.00
R6969:Sptb	UTSW	12	76608007	missense	probably damaging	1.00
R6987:Sptb	UTSW	12	76613247	missense	probably benign	0.00
R7023:Sptb	UTSW	12	76625088	missense	probably damaging	1.00
R7366:Sptb	UTSW	12	76604194	missense	probably damaging	1.00
R7379:Sptb	UTSW	12	76610877	missense	probably damaging	1.00
R7389:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7392:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7477:Sptb	UTSW	12	76628565	missense	probably damaging	1.00
R7653:Sptb	UTSW	12	76628497	missense	probably benign	0.06
R7684:Sptb	UTSW	12	76612195	missense	probably benign	0.06
R7733:Sptb	UTSW	12	76597921	splice site	probably null
R7846:Sptb	UTSW	12	76608526	nonsense	probably null
R8048:Sptb	UTSW	12	76628559	missense	probably benign	0.02
R8261:Sptb	UTSW	12	76621262	missense	probably benign	0.06
R8324:Sptb	UTSW	12	76619162	missense	possibly damaging	0.73
R8512:Sptb	UTSW	12	76602052	missense	possibly damaging	0.51
R8515:Sptb	UTSW	12	76612041	missense	probably benign	0.10
X0057:Sptb	UTSW	12	76630739	missense	probably benign
Z1176:Sptb	UTSW	12	76620733	nonsense	probably null
Z1177:Sptb	UTSW	12	76583584	missense	probably damaging	1.00
Z1177:Sptb	UTSW	12	76606445	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AGTAACCCAGGGTCAAGTCCACTTC -3'
(R):5'- GCGCACAGAGACGATTACCATAGG -3'

Sequencing Primer
(F):5'- GGGTCAAGTCCACTTCTCTAGC -3'
(R):5'- CGATTACCATAGGGTCAAGGC -3'

Posted On

2014-05-23