Incidental Mutation 'R1761:Bcl6'
ID 192804
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene Name B cell leukemia/lymphoma 6
Synonyms Bcl5
MMRRC Submission 039793-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R1761 (G1)
Quality Score 190
Status Not validated
Chromosome 16
Chromosomal Location 23783802-23807602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 23796292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 45 (A45D)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
AlphaFold P41183
Predicted Effect probably damaging
Transcript: ENSMUST00000023151
AA Change: A45D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: A45D

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,488,672 (GRCm39) H1268Y possibly damaging Het
Acan T A 7: 78,743,833 (GRCm39) Y621* probably null Het
Aig1 T C 10: 13,566,328 (GRCm39) Y152C probably damaging Het
Arhgap33 C T 7: 30,232,488 (GRCm39) probably null Het
Cbx5 T C 15: 103,121,607 (GRCm39) D10G possibly damaging Het
Ccdc191 A G 16: 43,763,873 (GRCm39) I445V probably benign Het
Cdk4 T A 10: 126,900,546 (GRCm39) probably benign Het
Chil6 A G 3: 106,301,654 (GRCm39) F149L probably damaging Het
Cntn5 T C 9: 10,172,059 (GRCm39) T42A probably benign Het
Cpn2 A T 16: 30,079,014 (GRCm39) I229N probably damaging Het
Cpne8 A G 15: 90,532,821 (GRCm39) V62A probably damaging Het
Cr2 A G 1: 194,837,431 (GRCm39) probably null Het
Crnn A T 3: 93,055,958 (GRCm39) H248L probably benign Het
Csn1s1 A G 5: 87,826,894 (GRCm39) S254G probably benign Het
Cubn A G 2: 13,494,128 (GRCm39) probably null Het
Dnah8 A G 17: 30,998,890 (GRCm39) N3525S probably damaging Het
Dpp3 A G 19: 4,971,177 (GRCm39) L220P probably benign Het
Fam110a T C 2: 151,812,125 (GRCm39) E215G probably benign Het
Fam20a A T 11: 109,568,664 (GRCm39) N287K probably damaging Het
Fat4 T C 3: 38,941,638 (GRCm39) V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 (GRCm39) R242C probably damaging Het
Gimap5 A T 6: 48,730,195 (GRCm39) Q255L probably damaging Het
Gm4787 A G 12: 81,423,950 (GRCm39) L736S probably benign Het
Gmeb1 G A 4: 131,962,198 (GRCm39) Q154* probably null Het
Gpr156 T C 16: 37,807,929 (GRCm39) L192P probably damaging Het
Gpr179 A C 11: 97,225,932 (GRCm39) S2074R probably benign Het
Hddc2 G T 10: 31,202,135 (GRCm39) D161Y probably damaging Het
Hlcs T C 16: 94,068,866 (GRCm39) D265G probably benign Het
Hspg2 A T 4: 137,241,984 (GRCm39) I573F possibly damaging Het
Il1b T C 2: 129,207,101 (GRCm39) K220E probably damaging Het
Il5 T C 11: 53,614,557 (GRCm39) I66T probably damaging Het
Irf6 G A 1: 192,851,609 (GRCm39) R400H probably damaging Het
Klra1 A T 6: 130,349,836 (GRCm39) Y201N probably damaging Het
Lmf2 A G 15: 89,236,916 (GRCm39) V442A possibly damaging Het
Mcm2 T C 6: 88,866,770 (GRCm39) I412M possibly damaging Het
Mlkl T A 8: 112,060,355 (GRCm39) L18F possibly damaging Het
Mug2 C A 6: 122,051,664 (GRCm39) H949N probably benign Het
Nf1 T C 11: 79,275,091 (GRCm39) F51L probably damaging Het
Or52j3 T G 7: 102,836,325 (GRCm39) C172W probably damaging Het
Or7d10 A T 9: 19,832,445 (GRCm39) *313C probably null Het
Or8k18 T G 2: 86,085,383 (GRCm39) Y218S probably damaging Het
P3h2 T C 16: 25,803,800 (GRCm39) E322G probably damaging Het
Pramel21 T C 4: 143,342,438 (GRCm39) Y182H probably benign Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,779,095 (GRCm39) probably null Het
Ptdss1 T C 13: 67,104,476 (GRCm39) V116A possibly damaging Het
Ranbp2 T C 10: 58,321,563 (GRCm39) V2620A probably benign Het
Robo2 A G 16: 73,831,912 (GRCm39) V256A probably damaging Het
Scg3 T A 9: 75,584,040 (GRCm39) I154F probably damaging Het
Scgn A T 13: 24,143,689 (GRCm39) F225Y probably damaging Het
Sec61b T C 4: 47,480,137 (GRCm39) C58R possibly damaging Het
Slc25a46 G T 18: 31,740,315 (GRCm39) Q96K possibly damaging Het
Spmip6 G A 4: 41,507,223 (GRCm39) P109L probably damaging Het
Sptb A G 12: 76,659,382 (GRCm39) F1173L probably damaging Het
Srcap T A 7: 127,134,017 (GRCm39) C893S probably damaging Het
Tet3 T C 6: 83,380,641 (GRCm39) E509G probably damaging Het
Timm10b C T 7: 105,332,915 (GRCm39) R897* probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tom1 T C 8: 75,778,179 (GRCm39) V87A probably benign Het
Tti1 T C 2: 157,849,617 (GRCm39) I541V probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubb1 A G 2: 174,298,689 (GRCm39) S124G probably benign Het
Vgll3 A T 16: 65,636,614 (GRCm39) D310V probably damaging Het
Vmac A G 17: 57,022,788 (GRCm39) L74P probably damaging Het
Zbtb1 A T 12: 76,432,595 (GRCm39) K194* probably null Het
Zfp429 A G 13: 67,544,195 (GRCm39) M76T probably benign Het
Zfp808 T A 13: 62,319,460 (GRCm39) C230S possibly damaging Het
Zfp980 A G 4: 145,428,612 (GRCm39) Y447C probably damaging Het
Zfp985 A G 4: 147,668,502 (GRCm39) T457A probably benign Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23,793,641 (GRCm39) missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23,796,319 (GRCm39) missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23,793,788 (GRCm39) splice site probably benign
IGL03271:Bcl6 APN 16 23,788,756 (GRCm39) missense probably benign 0.00
Adriatic UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
Catanzaro UTSW 16 23,784,976 (GRCm39) nonsense probably null
Density UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
nouvelle UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23,784,969 (GRCm39) missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23,791,344 (GRCm39) missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23,786,889 (GRCm39) missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23,784,905 (GRCm39) missense probably benign
R1134:Bcl6 UTSW 16 23,787,115 (GRCm39) missense probably benign
R1317:Bcl6 UTSW 16 23,796,292 (GRCm39) missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23,791,097 (GRCm39) missense probably benign 0.02
R1393:Bcl6 UTSW 16 23,796,316 (GRCm39) missense probably damaging 0.99
R2170:Bcl6 UTSW 16 23,793,680 (GRCm39) missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23,791,382 (GRCm39) nonsense probably null
R2293:Bcl6 UTSW 16 23,796,359 (GRCm39) missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23,786,869 (GRCm39) missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23,796,304 (GRCm39) missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23,787,203 (GRCm39) intron probably benign
R5015:Bcl6 UTSW 16 23,793,600 (GRCm39) missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23,791,496 (GRCm39) missense probably benign
R5185:Bcl6 UTSW 16 23,791,697 (GRCm39) missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23,791,926 (GRCm39) missense probably benign 0.01
R5659:Bcl6 UTSW 16 23,787,159 (GRCm39) nonsense probably null
R5909:Bcl6 UTSW 16 23,791,556 (GRCm39) missense probably benign
R6384:Bcl6 UTSW 16 23,793,615 (GRCm39) missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23,793,611 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,364 (GRCm39) missense possibly damaging 0.94
R7122:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7154:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7155:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7156:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7163:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7164:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7434:Bcl6 UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23,790,163 (GRCm39) critical splice donor site probably null
R7914:Bcl6 UTSW 16 23,788,761 (GRCm39) missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23,791,698 (GRCm39) missense probably benign 0.39
R8951:Bcl6 UTSW 16 23,793,704 (GRCm39) missense probably damaging 1.00
R8956:Bcl6 UTSW 16 23,793,716 (GRCm39) missense probably damaging 0.99
R9401:Bcl6 UTSW 16 23,791,107 (GRCm39) missense possibly damaging 0.77
R9471:Bcl6 UTSW 16 23,791,857 (GRCm39) missense probably benign 0.32
Z1176:Bcl6 UTSW 16 23,788,708 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTGCTGGCCTCAAATGCAC -3'
(R):5'- GTCTGTTCAGGCAAACACAACATGG -3'

Sequencing Primer
(F):5'- GCACCTTGGCTTTGATAGCATAAG -3'
(R):5'- ACAACATGGCCTCCCCG -3'
Posted On 2014-05-23