Incidental Mutation 'R1761:P3h2'
ID192805
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Nameprolyl 3-hydroxylase 2
SynonymsLeprel1
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location25959288-26105784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25985050 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 322 (E322G)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
Predicted Effect probably damaging
Transcript: ENSMUST00000039990
AA Change: E322G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: E322G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161878
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably benign Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25992798 missense probably damaging 1.00
IGL01012:P3h2 APN 16 25987248 missense probably damaging 0.98
IGL02393:P3h2 APN 16 25992825 missense probably damaging 1.00
IGL02436:P3h2 APN 16 25997200 missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25984999 missense probably benign 0.01
R0319:P3h2 UTSW 16 25970931 missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25969950 missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25997248 missense probably benign
R1290:P3h2 UTSW 16 25987203 missense probably damaging 0.99
R1300:P3h2 UTSW 16 25997236 nonsense probably null
R1467:P3h2 UTSW 16 25965868 splice site probably benign
R1643:P3h2 UTSW 16 25972291 missense probably benign 0.00
R1645:P3h2 UTSW 16 25997232 missense probably damaging 1.00
R4227:P3h2 UTSW 16 26105453 missense probably benign
R4273:P3h2 UTSW 16 26105221 missense probably benign 0.00
R4409:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4410:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4653:P3h2 UTSW 16 26105277 missense probably damaging 0.98
R4968:P3h2 UTSW 16 25992662 critical splice donor site probably null
R5190:P3h2 UTSW 16 25984949 missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25981153 missense probably benign 0.01
R6225:P3h2 UTSW 16 25965743 missense probably damaging 0.97
R6838:P3h2 UTSW 16 26105284 missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25992745 missense probably damaging 1.00
R7089:P3h2 UTSW 16 25965809 missense probably damaging 1.00
R7445:P3h2 UTSW 16 25985065 missense probably damaging 0.96
R7753:P3h2 UTSW 16 25970937 missense probably damaging 1.00
R8166:P3h2 UTSW 16 25992822 missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25992718 missense probably damaging 0.98
R8442:P3h2 UTSW 16 25987205 missense probably benign 0.05
R8812:P3h2 UTSW 16 25982717 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGATCAGAGTTGCAAATGTGGTCCC -3'
(R):5'- AAAGGTCCTCCCATCTGAGTACCTG -3'

Sequencing Primer
(F):5'- GTCACAAGATTGTGCCTATGAG -3'
(R):5'- CTGAGTACCTGAAACTGATCATCTG -3'
Posted On2014-05-23