Mutagenetix > Incidental Mutations

Incidental Mutation 'R1761:Robo2'

192811

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

039793-MU

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R1761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74035024 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 256 (V256A)

Ref Sequence

ENSEMBL: ENSMUSP00000154353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000116586
AA Change: V256A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: V256A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	330	402	1.3e-11	SMART
IGc2	434	499	3.73e-12	SMART
FN3	526	608	1.42e-15	SMART
FN3	640	725	3.54e-2	SMART
FN3	740	827	6.15e-11	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	1044	1069	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117200
AA Change: V256A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: V256A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117785
AA Change: V256A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: V256A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000226478
AA Change: V256A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000227347
AA Change: V256A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.1977

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,507,223	P109L	probably damaging	Het
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Acan	T	A	7: 79,094,085	Y621*	probably null	Het
Aig1	T	C	10: 13,690,584	Y152C	probably damaging	Het
Arhgap33	C	T	7: 30,533,063		probably null	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Cbx5	T	C	15: 103,213,180	D10G	possibly damaging	Het
Ccdc191	A	G	16: 43,943,510	I445V	probably benign	Het
Cdk4	T	A	10: 127,064,677		probably null	Het
Chil6	A	G	3: 106,394,338	F149L	probably damaging	Het
Cntn5	T	C	9: 10,172,054	T42A	probably benign	Het
Cpn2	A	T	16: 30,260,196	I229N	probably damaging	Het
Cpne8	A	G	15: 90,648,618	V62A	probably damaging	Het
Cr2	A	G	1: 195,155,123		probably null	Het
Crnn	A	T	3: 93,148,651	H248L	probably benign	Het
Csn1s1	A	G	5: 87,679,035	S254G	probably benign	Het
Cubn	A	G	2: 13,489,317		probably null	Het
Dnah8	A	G	17: 30,779,916	N3525S	probably damaging	Het
Dpp3	A	G	19: 4,921,149	L220P	probably benign	Het
Fam110a	T	C	2: 151,970,205	E215G	probably benign	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Fat4	T	C	3: 38,887,489	V177A	possibly damaging	Het
Fzd8	C	T	18: 9,213,643	R242C	probably damaging	Het
Gimap5	A	T	6: 48,753,261	Q255L	probably damaging	Het
Gm13083	T	C	4: 143,615,868	Y182H	probably benign	Het
Gm4787	A	G	12: 81,377,176	L736S	probably benign	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Gpr179	A	C	11: 97,335,106	S2074R	probably benign	Het
Hddc2	G	T	10: 31,326,139	D161Y	probably damaging	Het
Hlcs	T	C	16: 94,268,007	D265G	probably benign	Het
Hspg2	A	T	4: 137,514,673	I573F	possibly damaging	Het
Il1b	T	C	2: 129,365,181	K220E	probably damaging	Het
Il5	T	C	11: 53,723,730	I66T	probably damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Klra1	A	T	6: 130,372,873	Y201N	probably damaging	Het
Lmf2	A	G	15: 89,352,713	V442A	possibly damaging	Het
Mcm2	T	C	6: 88,889,788	I412M	possibly damaging	Het
Mlkl	T	A	8: 111,333,723	L18F	possibly damaging	Het
Mug2	C	A	6: 122,074,705	H949N	probably benign	Het
Nf1	T	C	11: 79,384,265	F51L	probably damaging	Het
Olfr1049	T	G	2: 86,255,039	Y218S	probably damaging	Het
Olfr592	T	G	7: 103,187,118	C172W	probably damaging	Het
Olfr77	A	T	9: 19,921,149	*313C	probably null	Het
P3h2	T	C	16: 25,985,050	E322G	probably damaging	Het
Psmg2	CTTCAGTT	CTTCAGTTCAGTT	18: 67,646,025		probably null	Het
Ptdss1	T	C	13: 66,956,412	V116A	possibly damaging	Het
Ranbp2	T	C	10: 58,485,741	V2620A	probably benign	Het
Scg3	T	A	9: 75,676,758	I154F	probably damaging	Het
Scgn	A	T	13: 23,959,706	F225Y	probably damaging	Het
Sec61b	T	C	4: 47,480,137	C58R	possibly damaging	Het
Slc25a46	G	T	18: 31,607,262	Q96K	possibly damaging	Het
Sptb	A	G	12: 76,612,608	F1173L	probably damaging	Het
Srcap	T	A	7: 127,534,845	C893S	probably damaging	Het
Tet3	T	C	6: 83,403,659	E509G	probably damaging	Het
Timm10b	C	T	7: 105,683,708	R897*	probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Tti1	T	C	2: 158,007,697	I541V	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Vgll3	A	T	16: 65,839,728	D310V	probably damaging	Het
Vmac	A	G	17: 56,715,788	L74P	probably damaging	Het
Zbtb1	A	T	12: 76,385,821	K194*	probably null	Het
Zfp429	A	G	13: 67,396,076	M76T	probably benign	Het
Zfp808	T	A	13: 62,171,646	C230S	possibly damaging	Het
Zfp980	A	G	4: 145,702,042	Y447C	probably damaging	Het
Zfp985	A	G	4: 147,584,045	T457A	probably benign	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0620:Robo2	UTSW	16	73967802	missense	possibly damaging	0.92
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2005:Robo2	UTSW	16	73933115	missense	possibly damaging	0.82
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4454:Robo2	UTSW	16	74352519	intron	probably benign
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6153:Robo2	UTSW	16	73920729	missense	probably damaging	1.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7720:Robo2	UTSW	16	73897015	missense	probably benign	0.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
R7849:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R7881:Robo2	UTSW	16	73920697	missense	probably benign	0.00
R7897:Robo2	UTSW	16	73898950	missense	probably benign
R8135:Robo2	UTSW	16	73933160	missense	probably benign	0.04
R8297:Robo2	UTSW	16	74015926	nonsense	probably null
R8307:Robo2	UTSW	16	73956610	missense	probably damaging	1.00
R8379:Robo2	UTSW	16	73933700	missense	probably damaging	0.99
R8393:Robo2	UTSW	16	73978494	missense	probably damaging	1.00
R8474:Robo2	UTSW	16	73948262	missense	probably damaging	1.00
R8500:Robo2	UTSW	16	73948340	missense	probably damaging	1.00
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00
Z1176:Robo2	UTSW	16	73933591	missense	probably benign	0.35
Z1177:Robo2	UTSW	16	73940299	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCACACAGCAGGTAAGATGCCA -3'
(R):5'- CCTGGAATGCTACTGAGGATCGCA -3'

Sequencing Primer
(F):5'- GGTGGTGGAACCATGAATGTTG -3'
(R):5'- GAGGCAGAAATTCACTGCATATC -3'

Posted On

2014-05-23