Incidental Mutation 'R1762:Serpinb2'
Institutional Source Beutler Lab
Gene Symbol Serpinb2
Ensembl Gene ENSMUSG00000062345
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 2
SynonymsPAI-2, ovalbumin, Planh2
MMRRC Submission 039794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1762 (G1)
Quality Score164
Status Not validated
Chromosomal Location107511423-107535478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107523890 bp
Amino Acid Change Histidine to Tyrosine at position 258 (H258Y)
Ref Sequence ENSEMBL: ENSMUSP00000065277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009356] [ENSMUST00000064916] [ENSMUST00000146597]
Predicted Effect probably benign
Transcript: ENSMUST00000009356
AA Change: H258Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009356
Gene: ENSMUSG00000062345
AA Change: H258Y

SERPIN 13 415 1.07e-188 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064916
AA Change: H258Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065277
Gene: ENSMUSG00000062345
AA Change: H258Y

SERPIN 13 415 1.07e-188 SMART
Predicted Effect unknown
Transcript: ENSMUST00000143832
AA Change: H134Y
SMART Domains Protein: ENSMUSP00000114751
Gene: ENSMUSG00000062345
AA Change: H134Y

SERPIN 1 189 2.36e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146597
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to a slight to mild reduction in platelet, lymphocyte, neutrophil, and monocyte cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 215 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,512 C190S probably benign Het
AA986860 G A 1: 130,737,688 probably null Het
Abca7 T C 10: 79,999,765 L289P probably damaging Het
Ache A G 5: 137,290,575 N181S possibly damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Adgrv1 T A 13: 81,506,146 H2922L probably benign Het
AI464131 T A 4: 41,498,553 Y359F possibly damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Baz1a G A 12: 54,909,020 R1095C probably damaging Het
Bcan T G 3: 87,993,625 I434L probably benign Het
Brca1 A C 11: 101,532,018 probably null Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cd55b T A 1: 130,388,655 R273* probably null Het
Cd74 T C 18: 60,811,318 V200A probably benign Het
Cd82 C A 2: 93,437,429 V8F probably damaging Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh4 A G 2: 179,797,480 D140G probably benign Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chd1l A G 3: 97,588,299 L361S probably damaging Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 T C 1: 139,237,531 S952G probably damaging Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dlc1 T A 8: 36,937,585 N350I probably benign Het
Dpp9 A G 17: 56,188,362 I801T probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg3 A G 18: 20,539,732 D820G probably damaging Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Eme2 T C 17: 24,893,393 H186R probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Etnk2 G T 1: 133,377,046 A336S probably benign Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
G6pc2 A T 2: 69,220,842 H93L possibly damaging Het
Gdf3 T C 6: 122,606,407 T334A possibly damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10110 A G 14: 89,897,389 noncoding transcript Het
Gm10563 C T 4: 155,635,880 probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm9637 T C 14: 19,402,408 noncoding transcript Het
Gpbp1 A T 13: 111,440,774 V194D probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gpr39 G A 1: 125,872,549 V346M possibly damaging Het
Gpr84 T A 15: 103,309,327 I108F probably damaging Het
Grid2 G T 6: 64,533,654 C756F probably damaging Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
Has2 T C 15: 56,681,610 R199G probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igf2bp2 A T 16: 22,083,947 Y59* probably null Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irx5 T A 8: 92,359,644 N118K probably damaging Het
Itk T C 11: 46,336,482 E438G probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kdm5b T A 1: 134,604,467 L461* probably null Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Lrrtm1 T C 6: 77,244,697 V379A probably benign Het
Mbd3l1 T G 9: 18,485,139 *187E probably null Het
Micu1 T A 10: 59,863,260 M453K possibly damaging Het
Mlh1 A T 9: 111,229,929 C676S probably damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b G A 2: 155,630,858 E1391K probably damaging Het
Myrfl A C 10: 116,798,593 M632R probably damaging Het
Naif1 T C 2: 32,454,890 V202A possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncor1 T C 11: 62,384,784 E525G possibly damaging Het
Nlrx1 T C 9: 44,263,640 M280V possibly damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrg1 T A 8: 31,822,323 H382L probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1107 A T 2: 87,071,921 I71N probably damaging Het
Olfr1148 G T 2: 87,833,665 V209F probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1284 A G 2: 111,379,573 D191G probably damaging Het
Olfr1490 G A 19: 13,654,504 R25H probably benign Het
Olfr303 T C 7: 86,395,145 M118V probably damaging Het
Olfr582 C A 7: 103,042,042 H183N probably damaging Het
Olfr596 C T 7: 103,310,221 R167C probably damaging Het
Olfr665 C T 7: 104,881,240 H178Y probably damaging Het
Olfr926 A G 9: 38,877,785 N203S probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pah A G 10: 87,567,468 Q235R possibly damaging Het
Pcdhb9 A G 18: 37,403,083 E710G probably benign Het
Pcnt T A 10: 76,355,137 probably null Het
Pdzk1 A T 3: 96,851,573 N98I probably benign Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkdc T A 16: 15,637,961 C25S probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rasal2 T C 1: 157,299,144 E90G possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rictor T C 15: 6,756,573 I190T probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Sbf2 T C 7: 110,312,758 T1694A probably benign Het
Sbno2 C T 10: 80,066,606 E486K probably damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Skint6 T C 4: 113,236,481 N155S probably damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc30a5 T C 13: 100,813,462 T371A probably damaging Het
Slit1 A T 19: 41,603,335 Y1283N probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Stx19 A T 16: 62,821,980 Q53L probably damaging Het
Tbc1d4 T C 14: 101,507,138 S351G possibly damaging Het
Tbx15 T A 3: 99,351,944 L377* probably null Het
Tecta A T 9: 42,375,309 Y684N probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b T A 1: 130,103,076 H1049Q possibly damaging Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Wnt5a T C 14: 28,522,891 V345A probably damaging Het
Xylt1 A T 7: 117,637,761 H579L probably benign Het
Zbtb4 A T 11: 69,778,917 Q822L probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zc3h12c A T 9: 52,115,781 S760R probably benign Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Serpinb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Serpinb2 APN 1 107524736 missense probably benign 0.04
IGL00870:Serpinb2 APN 1 107523070 missense probably damaging 1.00
IGL01535:Serpinb2 APN 1 107519773 critical splice donor site probably null
IGL01603:Serpinb2 APN 1 107522180 missense probably benign 0.28
IGL01721:Serpinb2 APN 1 107515603 missense probably damaging 1.00
IGL02536:Serpinb2 APN 1 107524949 unclassified probably benign
IGL03167:Serpinb2 APN 1 107522755 missense probably benign 0.04
IGL03184:Serpinb2 APN 1 107524877 missense probably damaging 1.00
R1728:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1728:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1728:Serpinb2 UTSW 1 107523890 missense probably benign
R1728:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1728:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1729:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107523890 missense probably benign
R1729:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1730:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107523890 missense probably benign
R1730:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1739:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107523890 missense probably benign
R1739:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1762:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1783:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107523890 missense probably benign
R1783:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1785:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107523890 missense probably benign
R1785:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1889:Serpinb2 UTSW 1 107524607 missense probably damaging 1.00
R1895:Serpinb2 UTSW 1 107524607 missense probably damaging 1.00
R2056:Serpinb2 UTSW 1 107523813 missense probably damaging 1.00
R2061:Serpinb2 UTSW 1 107522795 missense possibly damaging 0.87
R2186:Serpinb2 UTSW 1 107523964 splice site probably null
R4925:Serpinb2 UTSW 1 107515489 missense probably benign 0.37
R5150:Serpinb2 UTSW 1 107523209 critical splice donor site probably null
R5421:Serpinb2 UTSW 1 107523851 missense probably damaging 1.00
R5899:Serpinb2 UTSW 1 107519716 missense probably damaging 0.96
R6234:Serpinb2 UTSW 1 107524771 missense probably damaging 1.00
R6243:Serpinb2 UTSW 1 107523139 missense probably damaging 1.00
R7088:Serpinb2 UTSW 1 107524692 missense probably damaging 1.00
R7192:Serpinb2 UTSW 1 107524576 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- atatagagagagagagagagagagag -3'
Posted On2014-05-23