Incidental Mutation 'R1762:Tbx15'
ID 193077
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 039794-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R1762 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 99259260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 377 (L377*)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably null
Transcript: ENSMUST00000029462
AA Change: L377*
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: L377*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 219 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,665,425 (GRCm39) probably null Het
Abca7 T C 10: 79,835,599 (GRCm39) L289P probably damaging Het
Ache A G 5: 137,288,837 (GRCm39) N181S possibly damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Adgrv1 T A 13: 81,654,265 (GRCm39) H2922L probably benign Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Baz1a G A 12: 54,955,805 (GRCm39) R1095C probably damaging Het
Bcan T G 3: 87,900,932 (GRCm39) I434L probably benign Het
Brca1 A C 11: 101,422,844 (GRCm39) probably null Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55b T A 1: 130,316,392 (GRCm39) R273* probably null Het
Cd74 T C 18: 60,944,390 (GRCm39) V200A probably benign Het
Cd82 C A 2: 93,267,774 (GRCm39) V8F probably damaging Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cdh4 A G 2: 179,439,273 (GRCm39) D140G probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfh T C 1: 140,064,526 (GRCm39) K374R probably benign Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chd1l A G 3: 97,495,615 (GRCm39) L361S probably damaging Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 T C 1: 139,165,269 (GRCm39) S952G probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dlc1 T A 8: 37,404,739 (GRCm39) N350I probably benign Het
Dpp9 A G 17: 56,495,362 (GRCm39) I801T probably damaging Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsg3 A G 18: 20,672,789 (GRCm39) D820G probably damaging Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Eme2 T C 17: 25,112,367 (GRCm39) H186R probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,304,784 (GRCm39) A336S probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
G6pc2 A T 2: 69,051,186 (GRCm39) H93L possibly damaging Het
Gdf3 T C 6: 122,583,366 (GRCm39) T334A possibly damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Glrx2 C T 1: 143,615,478 (GRCm39) A27V possibly damaging Het
Gm10110 A G 14: 90,134,825 (GRCm39) noncoding transcript Het
Gm10563 C T 4: 155,720,337 (GRCm39) probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Gm9637 T C 14: 19,402,408 (GRCm38) noncoding transcript Het
Gpbp1 A T 13: 111,577,308 (GRCm39) V194D probably benign Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Gpr39 G A 1: 125,800,286 (GRCm39) V346M possibly damaging Het
Gpr84 T A 15: 103,217,754 (GRCm39) I108F probably damaging Het
Grid2 G T 6: 64,510,638 (GRCm39) C756F probably damaging Het
Grm7 G C 6: 111,335,256 (GRCm39) D556H probably damaging Het
Has2 T C 15: 56,545,006 (GRCm39) R199G probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Igf2bp2 A T 16: 21,902,697 (GRCm39) Y59* probably null Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Irx5 T A 8: 93,086,272 (GRCm39) N118K probably damaging Het
Itk T C 11: 46,227,309 (GRCm39) E438G probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kdm5b T A 1: 134,532,205 (GRCm39) L461* probably null Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Lrrtm1 T C 6: 77,221,680 (GRCm39) V379A probably benign Het
Mbd3l1 T G 9: 18,396,435 (GRCm39) *187E probably null Het
Micu1 T A 10: 59,699,082 (GRCm39) M453K possibly damaging Het
Mlh1 A T 9: 111,058,997 (GRCm39) C676S probably damaging Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mx2 G A 16: 97,339,903 (GRCm39) E20K probably benign Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Myh7b G A 2: 155,472,778 (GRCm39) E1391K probably damaging Het
Myorg T A 4: 41,498,553 (GRCm39) Y359F possibly damaging Het
Myrfl A C 10: 116,634,498 (GRCm39) M632R probably damaging Het
Naif1 T C 2: 32,344,902 (GRCm39) V202A possibly damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ncor1 T C 11: 62,275,610 (GRCm39) E525G possibly damaging Het
Nlrx1 T C 9: 44,174,937 (GRCm39) M280V possibly damaging Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrg1 T A 8: 32,312,351 (GRCm39) H382L probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Or10w1 G A 19: 13,631,868 (GRCm39) R25H probably benign Het
Or12e13 G T 2: 87,664,009 (GRCm39) V209F probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or4g17 A G 2: 111,209,918 (GRCm39) D191G probably damaging Het
Or52e19 C T 7: 102,959,428 (GRCm39) R167C probably damaging Het
Or52n3 C T 7: 104,530,447 (GRCm39) H178Y probably damaging Het
Or52r1b C A 7: 102,691,249 (GRCm39) H183N probably damaging Het
Or5aq1b A T 2: 86,902,265 (GRCm39) I71N probably damaging Het
Or6aa1 T C 7: 86,044,353 (GRCm39) M118V probably damaging Het
Or8d2b A G 9: 38,789,081 (GRCm39) N203S probably damaging Het
Pah A G 10: 87,403,330 (GRCm39) Q235R possibly damaging Het
Pcdhb9 A G 18: 37,536,136 (GRCm39) E710G probably benign Het
Pcnt T A 10: 76,190,971 (GRCm39) probably null Het
Pdzk1 A T 3: 96,758,889 (GRCm39) N98I probably benign Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkdc T A 16: 15,455,825 (GRCm39) C25S probably benign Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rasal2 T C 1: 157,126,714 (GRCm39) E90G possibly damaging Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C A 1: 133,286,720 (GRCm39) probably null Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Rictor T C 15: 6,786,054 (GRCm39) I190T probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sbf2 T C 7: 109,911,965 (GRCm39) T1694A probably benign Het
Sbno2 C T 10: 79,902,440 (GRCm39) E486K probably damaging Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr G T 1: 119,990,976 (GRCm39) E453D probably benign Het
Semp2l2b A T 10: 21,943,411 (GRCm39) C190S probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Skint6 T C 4: 113,093,678 (GRCm39) N155S probably damaging Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc30a5 T C 13: 100,949,970 (GRCm39) T371A probably damaging Het
Slit1 A T 19: 41,591,774 (GRCm39) Y1283N probably damaging Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Stx19 A T 16: 62,642,343 (GRCm39) Q53L probably damaging Het
Tbc1d4 T C 14: 101,744,574 (GRCm39) S351G possibly damaging Het
Tecta A T 9: 42,286,605 (GRCm39) Y684N probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b T A 1: 130,030,813 (GRCm39) H1049Q possibly damaging Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Wnt5a T C 14: 28,244,848 (GRCm39) V345A probably damaging Het
Xylt1 A T 7: 117,236,988 (GRCm39) H579L probably benign Het
Zbtb4 A T 11: 69,669,743 (GRCm39) Q822L probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zc3h12c A T 9: 52,027,081 (GRCm39) S760R probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATGTGTGCTCAAACATGTGAC -3'
(R):5'- GCCTGCCTGCATGACATACTGAAAC -3'

Sequencing Primer
(F):5'- GTGCTCAAACATGTGACATCATC -3'
(R):5'- TATTCCTGAGATCAGAGATGGAGTCC -3'
Posted On 2014-05-23