Incidental Mutation 'R1763:Rgs20'
ID 193151
Institutional Source Beutler Lab
Gene Symbol Rgs20
Ensembl Gene ENSMUSG00000002459
Gene Name regulator of G-protein signaling 20
Synonyms Rgsz1, 2900073E09Rik
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 4979799-5140508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4980863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 154 (R154Q)
Ref Sequence ENSEMBL: ENSMUSP00000113324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002533] [ENSMUST00000118000] [ENSMUST00000119256] [ENSMUST00000147158] [ENSMUST00000170566]
AlphaFold Q9QZB1
Predicted Effect probably damaging
Transcript: ENSMUST00000002533
AA Change: R185Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002533
Gene: ENSMUSG00000002459
AA Change: R185Q

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
RGS 113 229 2.09e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118000
AA Change: R318Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113398
Gene: ENSMUSG00000002459
AA Change: R318Q

DomainStartEndE-ValueType
low complexity region 123 135 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
RGS 246 362 2.09e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119256
AA Change: R154Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113324
Gene: ENSMUSG00000002459
AA Change: R154Q

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 82 198 2.09e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147158
SMART Domains Protein: ENSMUSP00000117380
Gene: ENSMUSG00000002459

DomainStartEndE-ValueType
low complexity region 92 104 N/A INTRINSIC
Pfam:RGS 146 200 2.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194052
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,529 (GRCm39) V401A probably benign Het
Abca4 G A 3: 121,904,330 (GRCm39) V794M probably benign Het
Abca4 A T 3: 121,957,479 (GRCm39) T772S probably damaging Het
Acox3 G A 5: 35,765,683 (GRCm39) probably null Het
Adamts17 A G 7: 66,797,463 (GRCm39) N1060S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Als2 T C 1: 59,214,150 (GRCm39) Y1346C probably benign Het
Apol10b A T 15: 77,469,215 (GRCm39) F321I probably benign Het
Atp5pb A G 3: 105,858,905 (GRCm39) probably null Het
Bloc1s5 A G 13: 38,803,060 (GRCm39) probably benign Het
Btbd9 T C 17: 30,553,271 (GRCm39) N397S possibly damaging Het
Cacna1d A G 14: 29,821,153 (GRCm39) V1121A probably benign Het
Cad G A 5: 31,218,295 (GRCm39) V460I probably damaging Het
Caprin2 A T 6: 148,744,619 (GRCm39) D935E probably damaging Het
Ccdc150 A T 1: 54,393,795 (GRCm39) K686N probably benign Het
Ccnt2 T C 1: 127,727,143 (GRCm39) F186L possibly damaging Het
Cd5l G A 3: 87,275,187 (GRCm39) probably null Het
Chrna7 A G 7: 62,749,000 (GRCm39) V494A probably benign Het
Clec2i T G 6: 128,872,388 (GRCm39) Y198* probably null Het
Col22a1 A G 15: 71,879,025 (GRCm39) V44A probably damaging Het
Cspg4 T A 9: 56,794,263 (GRCm39) I666N probably damaging Het
Cyp3a16 A T 5: 145,401,841 (GRCm39) probably null Het
Dlk1 G T 12: 109,424,045 (GRCm39) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 54,943,572 (GRCm39) probably benign Het
Dscc1 T A 15: 54,947,535 (GRCm39) H215L probably damaging Het
Dus1l C G 11: 120,686,497 (GRCm39) G15R probably benign Het
Eps8l1 G T 7: 4,474,822 (GRCm39) V268L probably benign Het
F2 A C 2: 91,465,251 (GRCm39) C104W probably damaging Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fmn2 T C 1: 174,329,832 (GRCm39) L74P unknown Het
Frmd6 G A 12: 70,940,396 (GRCm39) R347Q possibly damaging Het
Gabbr1 T G 17: 37,365,659 (GRCm39) S158A probably damaging Het
Galc T C 12: 98,200,525 (GRCm39) N295S probably damaging Het
Gm6408 A T 5: 146,419,132 (GRCm39) N49I probably damaging Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Grm8 C T 6: 27,285,866 (GRCm39) V849I possibly damaging Het
Hmcn2 A G 2: 31,204,602 (GRCm39) D59G probably damaging Het
Iars1 G A 13: 49,876,553 (GRCm39) probably null Het
Ifi27l2a C T 12: 103,403,941 (GRCm39) A127V possibly damaging Het
Ikbip A G 10: 90,932,343 (GRCm39) N329S probably damaging Het
Ikbke T C 1: 131,193,614 (GRCm39) T479A probably benign Het
Krt12 T A 11: 99,306,886 (GRCm39) N472I probably damaging Het
Lmnb2 A T 10: 80,743,025 (GRCm39) L193Q probably damaging Het
Lrriq4 T C 3: 30,704,401 (GRCm39) V128A probably benign Het
Map4k4 C A 1: 40,039,917 (GRCm39) probably benign Het
Mtmr7 T C 8: 41,004,852 (GRCm39) T575A probably benign Het
Myh13 G A 11: 67,225,402 (GRCm39) A256T probably benign Het
Napepld A G 5: 21,888,408 (GRCm39) Y14H probably benign Het
Npr1 T C 3: 90,366,644 (GRCm39) T552A probably damaging Het
Nudt15 A G 14: 73,759,087 (GRCm39) F127S probably benign Het
Nwd2 T A 5: 63,965,614 (GRCm39) S1733T probably benign Het
Or11a4 T C 17: 37,536,321 (GRCm39) F102L probably benign Het
Or4c102 A G 2: 88,422,780 (GRCm39) I211V probably benign Het
Or4c10b G A 2: 89,711,473 (GRCm39) G101E probably damaging Het
Or6z1 T G 7: 6,504,440 (GRCm39) I262L probably benign Het
Or8b44 A G 9: 38,410,334 (GRCm39) Y123C probably damaging Het
Paqr7 A T 4: 134,234,409 (GRCm39) I89F probably benign Het
Pidd1 C A 7: 141,019,543 (GRCm39) V706L probably benign Het
Polr3c A T 3: 96,620,911 (GRCm39) I469N probably damaging Het
Ppip5k1 A G 2: 121,179,028 (GRCm39) Y233H probably damaging Het
Psmc3 A G 2: 90,886,340 (GRCm39) T166A possibly damaging Het
Ptchd3 A T 11: 121,733,368 (GRCm39) I753L probably benign Het
Rad21 T C 15: 51,841,566 (GRCm39) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm39) E479G possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Sbf1 T C 15: 89,178,628 (GRCm39) D1449G probably damaging Het
Sema4g C T 19: 44,990,044 (GRCm39) R708* probably null Het
Septin9 T C 11: 117,181,254 (GRCm39) I18T probably benign Het
Serpinb6b A G 13: 33,162,041 (GRCm39) E280G probably damaging Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc6a21 G A 7: 44,937,158 (GRCm39) W554* probably null Het
Slco1a4 A C 6: 141,758,457 (GRCm39) I518R probably benign Het
Stab1 T A 14: 30,890,373 (GRCm39) Q26L probably benign Het
Stox1 A G 10: 62,503,744 (GRCm39) F104L probably damaging Het
Suco T C 1: 161,662,518 (GRCm39) K638E possibly damaging Het
Synpo T C 18: 60,735,856 (GRCm39) K458E probably damaging Het
Szt2 A T 4: 118,229,565 (GRCm39) W2820R unknown Het
Tmtc1 C A 6: 148,196,116 (GRCm39) G499W probably damaging Het
Tonsl A C 15: 76,522,266 (GRCm39) S242R probably damaging Het
Trpc4 G T 3: 54,102,243 (GRCm39) S47I possibly damaging Het
Zfp106 G A 2: 120,350,909 (GRCm39) R1581C probably benign Het
Zfp27 A G 7: 29,594,801 (GRCm39) L388P possibly damaging Het
Other mutations in Rgs20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rgs20 APN 1 5,140,238 (GRCm39) missense probably benign 0.04
IGL01433:Rgs20 APN 1 5,140,300 (GRCm39) missense possibly damaging 0.85
IGL01691:Rgs20 APN 1 4,987,145 (GRCm39) missense probably benign 0.00
R0573:Rgs20 UTSW 1 5,091,037 (GRCm39) missense possibly damaging 0.85
R1274:Rgs20 UTSW 1 4,982,670 (GRCm39) missense probably damaging 1.00
R1305:Rgs20 UTSW 1 5,091,262 (GRCm39) splice site probably null
R1513:Rgs20 UTSW 1 4,982,560 (GRCm39) missense probably damaging 1.00
R1568:Rgs20 UTSW 1 5,091,050 (GRCm39) missense probably benign 0.00
R1794:Rgs20 UTSW 1 4,980,795 (GRCm39) missense probably damaging 1.00
R2118:Rgs20 UTSW 1 4,987,113 (GRCm39) splice site probably benign
R2437:Rgs20 UTSW 1 5,140,370 (GRCm39) splice site probably null
R3029:Rgs20 UTSW 1 5,140,276 (GRCm39) missense probably benign 0.00
R4665:Rgs20 UTSW 1 5,091,231 (GRCm39) missense probably benign 0.00
R5014:Rgs20 UTSW 1 4,980,770 (GRCm39) missense probably damaging 1.00
R5433:Rgs20 UTSW 1 5,140,333 (GRCm39) missense possibly damaging 0.93
R5620:Rgs20 UTSW 1 4,982,666 (GRCm39) missense probably damaging 1.00
R5880:Rgs20 UTSW 1 4,994,104 (GRCm39) missense probably damaging 0.99
R5990:Rgs20 UTSW 1 4,982,553 (GRCm39) missense probably benign 0.11
R6188:Rgs20 UTSW 1 5,091,106 (GRCm39) frame shift probably null
R7323:Rgs20 UTSW 1 4,982,535 (GRCm39) critical splice donor site probably null
R7459:Rgs20 UTSW 1 4,980,857 (GRCm39) missense probably benign 0.04
R7467:Rgs20 UTSW 1 4,982,553 (GRCm39) missense probably benign 0.11
R8101:Rgs20 UTSW 1 4,982,638 (GRCm39) missense probably benign 0.16
R9087:Rgs20 UTSW 1 4,994,190 (GRCm39) missense possibly damaging 0.88
R9193:Rgs20 UTSW 1 5,091,067 (GRCm39) missense possibly damaging 0.65
R9443:Rgs20 UTSW 1 4,982,629 (GRCm39) nonsense probably null
R9725:Rgs20 UTSW 1 4,980,793 (GRCm39) nonsense probably null
Z1176:Rgs20 UTSW 1 5,140,337 (GRCm39) missense probably benign
Z1177:Rgs20 UTSW 1 5,091,242 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCTGCCCTTGAGAACATGCTAC -3'
(R):5'- TGTTTCTCTCAGCAGTGCAGACAG -3'

Sequencing Primer
(F):5'- GAGCACACTATCTTTCTAAGGCAG -3'
(R):5'- CAGTTAGGGCTCAGACTGTTAGAAC -3'
Posted On 2014-05-23