Incidental Mutation 'R1763:Ikbke'
Institutional Source Beutler Lab
Gene Symbol Ikbke
Ensembl Gene ENSMUSG00000042349
Gene Nameinhibitor of kappaB kinase epsilon
SynonymsIKK-i, IKKepsilon
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1763 (G1)
Quality Score225
Status Validated
Chromosomal Location131254343-131279606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131265877 bp
Amino Acid Change Threonine to Alanine at position 479 (T479A)
Ref Sequence ENSEMBL: ENSMUSP00000124190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000161764]
Predicted Effect probably benign
Transcript: ENSMUST00000062108
AA Change: T503A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349
AA Change: T503A

Pfam:Pkinase_Tyr 9 249 1.1e-29 PFAM
Pfam:Pkinase 9 301 6.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160748
Predicted Effect probably benign
Transcript: ENSMUST00000161764
AA Change: T479A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349
AA Change: T479A

Pfam:Pkinase 49 278 9.3e-31 PFAM
Pfam:Pkinase_Tyr 50 226 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186240
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Ikbke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ikbke APN 1 131270012 splice site probably null
IGL00703:Ikbke APN 1 131255302 utr 3 prime probably benign
IGL01079:Ikbke APN 1 131265647 missense possibly damaging 0.64
IGL01106:Ikbke APN 1 131260055 splice site probably benign
IGL01336:Ikbke APN 1 131273756 missense probably damaging 1.00
IGL01505:Ikbke APN 1 131255311 missense probably benign 0.00
IGL01564:Ikbke APN 1 131257921 missense probably benign 0.37
IGL01568:Ikbke APN 1 131257896 splice site probably null
IGL01668:Ikbke APN 1 131256938 missense probably benign 0.05
IGL01977:Ikbke APN 1 131272101 splice site probably benign
IGL02162:Ikbke APN 1 131273715 missense possibly damaging 0.69
IGL02653:Ikbke APN 1 131271835 missense possibly damaging 0.89
IGL02859:Ikbke APN 1 131270197 missense probably damaging 0.97
triathelon UTSW 1 131275267 frame shift probably null
R0028:Ikbke UTSW 1 131272184 missense possibly damaging 0.87
R0427:Ikbke UTSW 1 131257910 missense possibly damaging 0.62
R0607:Ikbke UTSW 1 131270184 critical splice donor site probably null
R1295:Ikbke UTSW 1 131270226 missense probably benign 0.03
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1720:Ikbke UTSW 1 131259210 missense possibly damaging 0.94
R1728:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1728:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1729:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1729:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1730:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1730:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1739:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1739:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1748:Ikbke UTSW 1 131259200 missense probably benign 0.02
R1762:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1762:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1783:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1783:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1784:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1784:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1785:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1785:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1794:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R2143:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2144:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2145:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2386:Ikbke UTSW 1 131259266 missense probably damaging 1.00
R2893:Ikbke UTSW 1 131270224 missense probably damaging 1.00
R4210:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4211:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4284:Ikbke UTSW 1 131275778 critical splice donor site probably null
R4461:Ikbke UTSW 1 131265922 missense probably benign
R4551:Ikbke UTSW 1 131258033 intron probably benign
R4560:Ikbke UTSW 1 131272120 missense probably damaging 1.00
R4849:Ikbke UTSW 1 131275267 frame shift probably null
R4855:Ikbke UTSW 1 131257111 splice site probably null
R4876:Ikbke UTSW 1 131275267 frame shift probably null
R4879:Ikbke UTSW 1 131275267 frame shift probably null
R4967:Ikbke UTSW 1 131275267 frame shift probably null
R4968:Ikbke UTSW 1 131275267 frame shift probably null
R4971:Ikbke UTSW 1 131275267 frame shift probably null
R5020:Ikbke UTSW 1 131273660 missense probably damaging 1.00
R5699:Ikbke UTSW 1 131276467 critical splice donor site probably null
R5814:Ikbke UTSW 1 131271779 missense probably damaging 0.96
R6392:Ikbke UTSW 1 131275146 splice site probably null
R6492:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R6899:Ikbke UTSW 1 131275762 missense probably damaging 1.00
R7552:Ikbke UTSW 1 131272150 nonsense probably null
R7583:Ikbke UTSW 1 131276479 missense probably damaging 0.99
R7652:Ikbke UTSW 1 131271832 missense probably damaging 1.00
R7806:Ikbke UTSW 1 131271898 missense probably damaging 1.00
R7984:Ikbke UTSW 1 131275786 missense probably null 1.00
R8211:Ikbke UTSW 1 131271778 missense probably damaging 0.96
R8309:Ikbke UTSW 1 131263328 nonsense probably null
R9012:Ikbke UTSW 1 131273453 missense probably damaging 0.97
X0026:Ikbke UTSW 1 131257986 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtttcaacctacttcaactttcattc -3'
Posted On2014-05-23