Incidental Mutation 'R1763:Fmn2'
ID193160
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Nameformin 2
Synonyms
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R1763 (G1)
Quality Score215
Status Validated
Chromosome1
Chromosomal Location174501825-174822729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174502266 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 74 (L74P)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
Predicted Effect unknown
Transcript: ENSMUST00000030039
AA Change: L74P
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: L74P

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174503319 missense unknown
IGL01085:Fmn2 APN 1 174695654 missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174502428 missense unknown
IGL02095:Fmn2 APN 1 174502601 missense unknown
IGL02330:Fmn2 APN 1 174609945 missense probably benign 0.38
IGL02552:Fmn2 APN 1 174695720 missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174582059 missense unknown
PIT4498001:Fmn2 UTSW 1 174612604 missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174647133 missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174791314 missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0306:Fmn2 UTSW 1 174609484 unclassified probably benign
R0325:Fmn2 UTSW 1 174609954 critical splice donor site probably null
R0403:Fmn2 UTSW 1 174694278 missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174581959 missense unknown
R0898:Fmn2 UTSW 1 174503460 missense unknown
R1202:Fmn2 UTSW 1 174612535 nonsense probably null
R1719:Fmn2 UTSW 1 174608458 unclassified probably benign
R1771:Fmn2 UTSW 1 174608776 unclassified probably benign
R1777:Fmn2 UTSW 1 174581922 missense unknown
R1831:Fmn2 UTSW 1 174609945 missense probably benign 0.38
R2259:Fmn2 UTSW 1 174502932 missense unknown
R2960:Fmn2 UTSW 1 174609819 missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174502626 missense unknown
R3840:Fmn2 UTSW 1 174582033 frame shift probably null
R4207:Fmn2 UTSW 1 174581955 missense unknown
R4679:Fmn2 UTSW 1 174503162 missense unknown
R4779:Fmn2 UTSW 1 174609895 missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174581961 missense unknown
R4926:Fmn2 UTSW 1 174502415 missense unknown
R5007:Fmn2 UTSW 1 174744300 missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174821228 missense probably benign 0.04
R5324:Fmn2 UTSW 1 174608880 unclassified probably benign
R5353:Fmn2 UTSW 1 174503006 missense unknown
R5420:Fmn2 UTSW 1 174698778 nonsense probably null
R5607:Fmn2 UTSW 1 174609811 missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174582037 missense unknown
R5982:Fmn2 UTSW 1 174502453 missense unknown
R6148:Fmn2 UTSW 1 174666663 missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174612553 missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174609583 unclassified probably benign
R6647:Fmn2 UTSW 1 174593104 missense unknown
R6835:Fmn2 UTSW 1 174699669 missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174609203 unclassified probably benign
R7340:Fmn2 UTSW 1 174609203 unclassified probably benign
R7378:Fmn2 UTSW 1 174609203 unclassified probably benign
R7457:Fmn2 UTSW 1 174503737 intron probably null
R7474:Fmn2 UTSW 1 174609203 unclassified probably benign
R7564:Fmn2 UTSW 1 174609574 missense unknown
R7582:Fmn2 UTSW 1 174698790 missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174666649 missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174609203 unclassified probably benign
R8035:Fmn2 UTSW 1 174719871 missense probably damaging 1.00
RF010:Fmn2 UTSW 1 174582015 missense unknown
Z1176:Fmn2 UTSW 1 174608394 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCACCGCGCATTATGCAAAG -3'
(R):5'- AGCCGCAGTTTCCAAATCCTCC -3'

Sequencing Primer
(F):5'- CATTATGCAAAGCGGCAGC -3'
(R):5'- GATCACCTCGAAAGGGTCAGC -3'
Posted On2014-05-23