Incidental Mutation 'R1763:Olfr1189'
ID193165
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1763 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88592436 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably benign
Transcript: ENSMUST00000090700
AA Change: I211V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: I211V

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213679
AA Change: I211V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0565:Olfr1189 UTSW 2 88592009 missense probably benign 0.39
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1847:Olfr1189 UTSW 2 88592172 missense probably damaging 1.00
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4410:Olfr1189 UTSW 2 88592421 missense probably benign 0.03
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5005:Olfr1189 UTSW 2 88592004 missense probably benign 0.00
R5174:Olfr1189 UTSW 2 88592648 missense probably damaging 1.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
R7522:Olfr1189 UTSW 2 88592661 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTATGTCGCCATCTGTAAGCCTC -3'
(R):5'- TAGTGGGACCCCTGTTTTCTGCAC -3'

Sequencing Primer
(F):5'- CCTCTGCACTACGTGAAAATGATG -3'
(R):5'- ATGACACAGCCATTGCTTTG -3'
Posted On2014-05-23