Incidental Mutation 'R1763:Lrriq4'
ID 193171
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Name leucine-rich repeats and IQ motif containing 4
Synonyms 4930558O21Rik
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 30698656-30726580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30704401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000103900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
AlphaFold A6H6A4
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108265
AA Change: V128A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: V128A

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108267
AA Change: V143A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: V143A

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172350
AA Change: V143A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: V143A

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,529 (GRCm39) V401A probably benign Het
Abca4 G A 3: 121,904,330 (GRCm39) V794M probably benign Het
Abca4 A T 3: 121,957,479 (GRCm39) T772S probably damaging Het
Acox3 G A 5: 35,765,683 (GRCm39) probably null Het
Adamts17 A G 7: 66,797,463 (GRCm39) N1060S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Als2 T C 1: 59,214,150 (GRCm39) Y1346C probably benign Het
Apol10b A T 15: 77,469,215 (GRCm39) F321I probably benign Het
Atp5pb A G 3: 105,858,905 (GRCm39) probably null Het
Bloc1s5 A G 13: 38,803,060 (GRCm39) probably benign Het
Btbd9 T C 17: 30,553,271 (GRCm39) N397S possibly damaging Het
Cacna1d A G 14: 29,821,153 (GRCm39) V1121A probably benign Het
Cad G A 5: 31,218,295 (GRCm39) V460I probably damaging Het
Caprin2 A T 6: 148,744,619 (GRCm39) D935E probably damaging Het
Ccdc150 A T 1: 54,393,795 (GRCm39) K686N probably benign Het
Ccnt2 T C 1: 127,727,143 (GRCm39) F186L possibly damaging Het
Cd5l G A 3: 87,275,187 (GRCm39) probably null Het
Chrna7 A G 7: 62,749,000 (GRCm39) V494A probably benign Het
Clec2i T G 6: 128,872,388 (GRCm39) Y198* probably null Het
Col22a1 A G 15: 71,879,025 (GRCm39) V44A probably damaging Het
Cspg4 T A 9: 56,794,263 (GRCm39) I666N probably damaging Het
Cyp3a16 A T 5: 145,401,841 (GRCm39) probably null Het
Dlk1 G T 12: 109,424,045 (GRCm39) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 54,943,572 (GRCm39) probably benign Het
Dscc1 T A 15: 54,947,535 (GRCm39) H215L probably damaging Het
Dus1l C G 11: 120,686,497 (GRCm39) G15R probably benign Het
Eps8l1 G T 7: 4,474,822 (GRCm39) V268L probably benign Het
F2 A C 2: 91,465,251 (GRCm39) C104W probably damaging Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fmn2 T C 1: 174,329,832 (GRCm39) L74P unknown Het
Frmd6 G A 12: 70,940,396 (GRCm39) R347Q possibly damaging Het
Gabbr1 T G 17: 37,365,659 (GRCm39) S158A probably damaging Het
Galc T C 12: 98,200,525 (GRCm39) N295S probably damaging Het
Gm6408 A T 5: 146,419,132 (GRCm39) N49I probably damaging Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Grm8 C T 6: 27,285,866 (GRCm39) V849I possibly damaging Het
Hmcn2 A G 2: 31,204,602 (GRCm39) D59G probably damaging Het
Iars1 G A 13: 49,876,553 (GRCm39) probably null Het
Ifi27l2a C T 12: 103,403,941 (GRCm39) A127V possibly damaging Het
Ikbip A G 10: 90,932,343 (GRCm39) N329S probably damaging Het
Ikbke T C 1: 131,193,614 (GRCm39) T479A probably benign Het
Krt12 T A 11: 99,306,886 (GRCm39) N472I probably damaging Het
Lmnb2 A T 10: 80,743,025 (GRCm39) L193Q probably damaging Het
Map4k4 C A 1: 40,039,917 (GRCm39) probably benign Het
Mtmr7 T C 8: 41,004,852 (GRCm39) T575A probably benign Het
Myh13 G A 11: 67,225,402 (GRCm39) A256T probably benign Het
Napepld A G 5: 21,888,408 (GRCm39) Y14H probably benign Het
Npr1 T C 3: 90,366,644 (GRCm39) T552A probably damaging Het
Nudt15 A G 14: 73,759,087 (GRCm39) F127S probably benign Het
Nwd2 T A 5: 63,965,614 (GRCm39) S1733T probably benign Het
Or11a4 T C 17: 37,536,321 (GRCm39) F102L probably benign Het
Or4c102 A G 2: 88,422,780 (GRCm39) I211V probably benign Het
Or4c10b G A 2: 89,711,473 (GRCm39) G101E probably damaging Het
Or6z1 T G 7: 6,504,440 (GRCm39) I262L probably benign Het
Or8b44 A G 9: 38,410,334 (GRCm39) Y123C probably damaging Het
Paqr7 A T 4: 134,234,409 (GRCm39) I89F probably benign Het
Pidd1 C A 7: 141,019,543 (GRCm39) V706L probably benign Het
Polr3c A T 3: 96,620,911 (GRCm39) I469N probably damaging Het
Ppip5k1 A G 2: 121,179,028 (GRCm39) Y233H probably damaging Het
Psmc3 A G 2: 90,886,340 (GRCm39) T166A possibly damaging Het
Ptchd3 A T 11: 121,733,368 (GRCm39) I753L probably benign Het
Rad21 T C 15: 51,841,566 (GRCm39) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm39) E479G possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rgs20 C T 1: 4,980,863 (GRCm39) R154Q probably damaging Het
Sbf1 T C 15: 89,178,628 (GRCm39) D1449G probably damaging Het
Sema4g C T 19: 44,990,044 (GRCm39) R708* probably null Het
Septin9 T C 11: 117,181,254 (GRCm39) I18T probably benign Het
Serpinb6b A G 13: 33,162,041 (GRCm39) E280G probably damaging Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc6a21 G A 7: 44,937,158 (GRCm39) W554* probably null Het
Slco1a4 A C 6: 141,758,457 (GRCm39) I518R probably benign Het
Stab1 T A 14: 30,890,373 (GRCm39) Q26L probably benign Het
Stox1 A G 10: 62,503,744 (GRCm39) F104L probably damaging Het
Suco T C 1: 161,662,518 (GRCm39) K638E possibly damaging Het
Synpo T C 18: 60,735,856 (GRCm39) K458E probably damaging Het
Szt2 A T 4: 118,229,565 (GRCm39) W2820R unknown Het
Tmtc1 C A 6: 148,196,116 (GRCm39) G499W probably damaging Het
Tonsl A C 15: 76,522,266 (GRCm39) S242R probably damaging Het
Trpc4 G T 3: 54,102,243 (GRCm39) S47I possibly damaging Het
Zfp106 G A 2: 120,350,909 (GRCm39) R1581C probably benign Het
Zfp27 A G 7: 29,594,801 (GRCm39) L388P possibly damaging Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30,705,104 (GRCm39) splice site probably null
IGL01289:Lrriq4 APN 3 30,704,542 (GRCm39) missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30,704,896 (GRCm39) missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30,709,788 (GRCm39) missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30,709,873 (GRCm39) missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30,704,472 (GRCm39) missense possibly damaging 0.46
R1440:Lrriq4 UTSW 3 30,704,910 (GRCm39) missense probably damaging 1.00
R1446:Lrriq4 UTSW 3 30,704,727 (GRCm39) missense probably benign 0.00
R1597:Lrriq4 UTSW 3 30,705,037 (GRCm39) missense probably damaging 1.00
R1923:Lrriq4 UTSW 3 30,713,242 (GRCm39) missense probably benign 0.13
R4024:Lrriq4 UTSW 3 30,704,422 (GRCm39) missense possibly damaging 0.46
R4026:Lrriq4 UTSW 3 30,704,422 (GRCm39) missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30,704,892 (GRCm39) missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30,714,196 (GRCm39) missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30,705,086 (GRCm39) missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30,704,632 (GRCm39) missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30,699,481 (GRCm39) start codon destroyed probably null
R5487:Lrriq4 UTSW 3 30,714,144 (GRCm39) missense probably benign 0.16
R6147:Lrriq4 UTSW 3 30,713,228 (GRCm39) missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30,704,551 (GRCm39) missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30,709,882 (GRCm39) missense probably damaging 1.00
R6624:Lrriq4 UTSW 3 30,704,929 (GRCm39) missense probably benign 0.01
R7032:Lrriq4 UTSW 3 30,709,850 (GRCm39) nonsense probably null
R8111:Lrriq4 UTSW 3 30,709,930 (GRCm39) missense possibly damaging 0.87
R8786:Lrriq4 UTSW 3 30,704,752 (GRCm39) missense probably benign 0.02
R8862:Lrriq4 UTSW 3 30,705,088 (GRCm39) missense probably damaging 1.00
R8897:Lrriq4 UTSW 3 30,709,807 (GRCm39) missense probably damaging 1.00
R9021:Lrriq4 UTSW 3 30,704,401 (GRCm39) missense probably benign 0.29
R9720:Lrriq4 UTSW 3 30,714,077 (GRCm39) missense probably damaging 1.00
Z1177:Lrriq4 UTSW 3 30,704,145 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATGGTTCCAACCAGGGGTTGAAG -3'
(R):5'- AGGGAAAACCTCGAAGTGATTCTGC -3'

Sequencing Primer
(F):5'- GTTGAAGACCATCCCGTCAGAG -3'
(R):5'- TCAGGTAGATCTCCCTGAGC -3'
Posted On 2014-05-23