Incidental Mutation 'R1763:Trpc4'
ID 193172
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Name transient receptor potential cation channel, subfamily C, member 4
Synonyms Trrp4, Trp4, CCE1, STRPC4
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 54063456-54225892 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 54102243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 47 (S47I)
Ref Sequence ENSEMBL: ENSMUSP00000143593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
AlphaFold Q9QUQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000029311
AA Change: S47I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: S47I

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199399
Predicted Effect possibly damaging
Transcript: ENSMUST00000200048
AA Change: S47I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: S47I

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200341
AA Change: S47I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748
AA Change: S47I

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,529 (GRCm39) V401A probably benign Het
Abca4 G A 3: 121,904,330 (GRCm39) V794M probably benign Het
Abca4 A T 3: 121,957,479 (GRCm39) T772S probably damaging Het
Acox3 G A 5: 35,765,683 (GRCm39) probably null Het
Adamts17 A G 7: 66,797,463 (GRCm39) N1060S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Als2 T C 1: 59,214,150 (GRCm39) Y1346C probably benign Het
Apol10b A T 15: 77,469,215 (GRCm39) F321I probably benign Het
Atp5pb A G 3: 105,858,905 (GRCm39) probably null Het
Bloc1s5 A G 13: 38,803,060 (GRCm39) probably benign Het
Btbd9 T C 17: 30,553,271 (GRCm39) N397S possibly damaging Het
Cacna1d A G 14: 29,821,153 (GRCm39) V1121A probably benign Het
Cad G A 5: 31,218,295 (GRCm39) V460I probably damaging Het
Caprin2 A T 6: 148,744,619 (GRCm39) D935E probably damaging Het
Ccdc150 A T 1: 54,393,795 (GRCm39) K686N probably benign Het
Ccnt2 T C 1: 127,727,143 (GRCm39) F186L possibly damaging Het
Cd5l G A 3: 87,275,187 (GRCm39) probably null Het
Chrna7 A G 7: 62,749,000 (GRCm39) V494A probably benign Het
Clec2i T G 6: 128,872,388 (GRCm39) Y198* probably null Het
Col22a1 A G 15: 71,879,025 (GRCm39) V44A probably damaging Het
Cspg4 T A 9: 56,794,263 (GRCm39) I666N probably damaging Het
Cyp3a16 A T 5: 145,401,841 (GRCm39) probably null Het
Dlk1 G T 12: 109,424,045 (GRCm39) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 54,943,572 (GRCm39) probably benign Het
Dscc1 T A 15: 54,947,535 (GRCm39) H215L probably damaging Het
Dus1l C G 11: 120,686,497 (GRCm39) G15R probably benign Het
Eps8l1 G T 7: 4,474,822 (GRCm39) V268L probably benign Het
F2 A C 2: 91,465,251 (GRCm39) C104W probably damaging Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fmn2 T C 1: 174,329,832 (GRCm39) L74P unknown Het
Frmd6 G A 12: 70,940,396 (GRCm39) R347Q possibly damaging Het
Gabbr1 T G 17: 37,365,659 (GRCm39) S158A probably damaging Het
Galc T C 12: 98,200,525 (GRCm39) N295S probably damaging Het
Gm6408 A T 5: 146,419,132 (GRCm39) N49I probably damaging Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Grm8 C T 6: 27,285,866 (GRCm39) V849I possibly damaging Het
Hmcn2 A G 2: 31,204,602 (GRCm39) D59G probably damaging Het
Iars1 G A 13: 49,876,553 (GRCm39) probably null Het
Ifi27l2a C T 12: 103,403,941 (GRCm39) A127V possibly damaging Het
Ikbip A G 10: 90,932,343 (GRCm39) N329S probably damaging Het
Ikbke T C 1: 131,193,614 (GRCm39) T479A probably benign Het
Krt12 T A 11: 99,306,886 (GRCm39) N472I probably damaging Het
Lmnb2 A T 10: 80,743,025 (GRCm39) L193Q probably damaging Het
Lrriq4 T C 3: 30,704,401 (GRCm39) V128A probably benign Het
Map4k4 C A 1: 40,039,917 (GRCm39) probably benign Het
Mtmr7 T C 8: 41,004,852 (GRCm39) T575A probably benign Het
Myh13 G A 11: 67,225,402 (GRCm39) A256T probably benign Het
Napepld A G 5: 21,888,408 (GRCm39) Y14H probably benign Het
Npr1 T C 3: 90,366,644 (GRCm39) T552A probably damaging Het
Nudt15 A G 14: 73,759,087 (GRCm39) F127S probably benign Het
Nwd2 T A 5: 63,965,614 (GRCm39) S1733T probably benign Het
Or11a4 T C 17: 37,536,321 (GRCm39) F102L probably benign Het
Or4c102 A G 2: 88,422,780 (GRCm39) I211V probably benign Het
Or4c10b G A 2: 89,711,473 (GRCm39) G101E probably damaging Het
Or6z1 T G 7: 6,504,440 (GRCm39) I262L probably benign Het
Or8b44 A G 9: 38,410,334 (GRCm39) Y123C probably damaging Het
Paqr7 A T 4: 134,234,409 (GRCm39) I89F probably benign Het
Pidd1 C A 7: 141,019,543 (GRCm39) V706L probably benign Het
Polr3c A T 3: 96,620,911 (GRCm39) I469N probably damaging Het
Ppip5k1 A G 2: 121,179,028 (GRCm39) Y233H probably damaging Het
Psmc3 A G 2: 90,886,340 (GRCm39) T166A possibly damaging Het
Ptchd3 A T 11: 121,733,368 (GRCm39) I753L probably benign Het
Rad21 T C 15: 51,841,566 (GRCm39) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm39) E479G possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rgs20 C T 1: 4,980,863 (GRCm39) R154Q probably damaging Het
Sbf1 T C 15: 89,178,628 (GRCm39) D1449G probably damaging Het
Sema4g C T 19: 44,990,044 (GRCm39) R708* probably null Het
Septin9 T C 11: 117,181,254 (GRCm39) I18T probably benign Het
Serpinb6b A G 13: 33,162,041 (GRCm39) E280G probably damaging Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc6a21 G A 7: 44,937,158 (GRCm39) W554* probably null Het
Slco1a4 A C 6: 141,758,457 (GRCm39) I518R probably benign Het
Stab1 T A 14: 30,890,373 (GRCm39) Q26L probably benign Het
Stox1 A G 10: 62,503,744 (GRCm39) F104L probably damaging Het
Suco T C 1: 161,662,518 (GRCm39) K638E possibly damaging Het
Synpo T C 18: 60,735,856 (GRCm39) K458E probably damaging Het
Szt2 A T 4: 118,229,565 (GRCm39) W2820R unknown Het
Tmtc1 C A 6: 148,196,116 (GRCm39) G499W probably damaging Het
Tonsl A C 15: 76,522,266 (GRCm39) S242R probably damaging Het
Zfp106 G A 2: 120,350,909 (GRCm39) R1581C probably benign Het
Zfp27 A G 7: 29,594,801 (GRCm39) L388P possibly damaging Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54,209,596 (GRCm39) missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54,129,983 (GRCm39) missense probably benign 0.01
IGL01475:Trpc4 APN 3 54,173,828 (GRCm39) missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54,209,567 (GRCm39) missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54,173,495 (GRCm39) splice site probably benign
IGL02134:Trpc4 APN 3 54,223,075 (GRCm39) missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54,129,783 (GRCm39) missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54,198,653 (GRCm39) missense probably damaging 0.97
IGL02549:Trpc4 APN 3 54,129,770 (GRCm39) missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54,206,667 (GRCm39) missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54,206,695 (GRCm39) splice site probably benign
R0498:Trpc4 UTSW 3 54,198,632 (GRCm39) missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54,209,511 (GRCm39) splice site probably benign
R0609:Trpc4 UTSW 3 54,102,189 (GRCm39) missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54,102,423 (GRCm39) missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54,223,236 (GRCm39) missense probably benign 0.02
R1623:Trpc4 UTSW 3 54,206,600 (GRCm39) missense probably damaging 1.00
R1843:Trpc4 UTSW 3 54,187,415 (GRCm39) missense probably benign 0.19
R1856:Trpc4 UTSW 3 54,187,410 (GRCm39) missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54,187,311 (GRCm39) missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54,209,614 (GRCm39) missense probably benign 0.03
R2441:Trpc4 UTSW 3 54,129,704 (GRCm39) missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54,198,761 (GRCm39) missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54,225,433 (GRCm39) missense probably benign 0.22
R3931:Trpc4 UTSW 3 54,225,516 (GRCm39) missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54,209,639 (GRCm39) missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54,102,217 (GRCm39) missense probably benign 0.11
R5284:Trpc4 UTSW 3 54,187,368 (GRCm39) missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54,206,599 (GRCm39) missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54,223,263 (GRCm39) missense probably damaging 1.00
R6276:Trpc4 UTSW 3 54,225,441 (GRCm39) missense probably benign 0.25
R6335:Trpc4 UTSW 3 54,224,995 (GRCm39) critical splice donor site probably null
R7082:Trpc4 UTSW 3 54,206,519 (GRCm39) nonsense probably null
R7215:Trpc4 UTSW 3 54,102,317 (GRCm39) missense possibly damaging 0.83
R7299:Trpc4 UTSW 3 54,225,048 (GRCm39) missense possibly damaging 0.87
R7423:Trpc4 UTSW 3 54,225,450 (GRCm39) missense probably benign
R7459:Trpc4 UTSW 3 54,198,653 (GRCm39) missense probably damaging 0.97
R7538:Trpc4 UTSW 3 54,225,516 (GRCm39) missense possibly damaging 0.92
R7542:Trpc4 UTSW 3 54,223,075 (GRCm39) missense probably damaging 1.00
R7823:Trpc4 UTSW 3 54,209,640 (GRCm39) nonsense probably null
R7868:Trpc4 UTSW 3 54,209,707 (GRCm39) missense probably benign 0.00
R8046:Trpc4 UTSW 3 54,102,335 (GRCm39) missense probably damaging 1.00
R8164:Trpc4 UTSW 3 54,223,226 (GRCm39) missense probably benign 0.31
R8235:Trpc4 UTSW 3 54,209,669 (GRCm39) missense probably benign 0.01
R8263:Trpc4 UTSW 3 54,129,756 (GRCm39) missense probably damaging 0.99
R8438:Trpc4 UTSW 3 54,129,674 (GRCm39) missense possibly damaging 0.90
R8854:Trpc4 UTSW 3 54,102,122 (GRCm39) nonsense probably null
R8987:Trpc4 UTSW 3 54,102,132 (GRCm39) missense probably benign 0.09
R9023:Trpc4 UTSW 3 54,102,254 (GRCm39) missense possibly damaging 0.52
R9196:Trpc4 UTSW 3 54,129,872 (GRCm39) missense probably damaging 1.00
R9210:Trpc4 UTSW 3 54,173,741 (GRCm39) missense probably benign 0.07
R9350:Trpc4 UTSW 3 54,209,610 (GRCm39) missense probably damaging 1.00
R9600:Trpc4 UTSW 3 54,102,248 (GRCm39) nonsense probably null
R9605:Trpc4 UTSW 3 54,225,550 (GRCm39) missense probably benign
R9644:Trpc4 UTSW 3 54,129,699 (GRCm39) missense probably damaging 1.00
R9749:Trpc4 UTSW 3 54,102,302 (GRCm39) missense probably damaging 1.00
R9755:Trpc4 UTSW 3 54,223,215 (GRCm39) missense probably damaging 1.00
X0066:Trpc4 UTSW 3 54,102,171 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCTGAAGCATGGCTCAGTTC -3'
(R):5'- TGCTTGTTTCCAACAACAGTCGCTC -3'

Sequencing Primer
(F):5'- CTGAAGCATGGCTCAGTTCTATTAC -3'
(R):5'- Tacacacacacacacacacac -3'
Posted On 2014-05-23