Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Trpc4'

193172

Institutional Source

Beutler Lab

Gene Symbol

Trpc4

Ensembl Gene

ENSMUSG00000027748

Gene Name

transient receptor potential cation channel, subfamily C, member 4

Synonyms

Trrp4, STRPC4, Trp4, CCE1

MMRRC Submission

039795-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54156035-54318471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 54194822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 47 (S47I)

Ref Sequence

ENSEMBL: ENSMUSP00000143593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]

AlphaFold

Q9QUQ5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029311
AA Change: S47I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: S47I

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	4e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.2e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	4.2e-33	PFAM
low complexity region	763	780	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199399

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200048
AA Change: S47I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: S47I

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.1e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	3.5e-33	PFAM
low complexity region	763	782	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200341
AA Change: S47I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748
AA Change: S47I

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	6.4e-33	PFAM
transmembrane domain	331	351	N/A	INTRINSIC
transmembrane domain	366	383	N/A	INTRINSIC

Meta Mutation Damage Score

0.1720

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Trpc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Trpc4	APN	3	54302175	missense	probably damaging	1.00
IGL01067:Trpc4	APN	3	54222562	missense	probably benign	0.01
IGL01475:Trpc4	APN	3	54266407	missense	possibly damaging	0.87
IGL01544:Trpc4	APN	3	54302146	missense	probably damaging	0.99
IGL01688:Trpc4	APN	3	54266074	splice site	probably benign
IGL02134:Trpc4	APN	3	54315654	missense	possibly damaging	0.46
IGL02237:Trpc4	APN	3	54222362	missense	probably damaging	1.00
IGL02301:Trpc4	APN	3	54291232	missense	probably damaging	0.97
IGL02549:Trpc4	APN	3	54222349	missense	possibly damaging	0.92
IGL02742:Trpc4	APN	3	54299246	missense	probably damaging	1.00
IGL02815:Trpc4	APN	3	54299274	splice site	probably benign
R0498:Trpc4	UTSW	3	54291211	missense	probably damaging	1.00
R0555:Trpc4	UTSW	3	54302090	splice site	probably benign
R0609:Trpc4	UTSW	3	54194768	missense	probably damaging	1.00
R1351:Trpc4	UTSW	3	54195002	missense	probably damaging	1.00
R1595:Trpc4	UTSW	3	54315815	missense	probably benign	0.02
R1623:Trpc4	UTSW	3	54299179	missense	probably damaging	1.00
R1843:Trpc4	UTSW	3	54279994	missense	probably benign	0.19
R1856:Trpc4	UTSW	3	54279989	missense	probably damaging	1.00
R1936:Trpc4	UTSW	3	54279890	missense	probably damaging	1.00
R2196:Trpc4	UTSW	3	54302193	missense	probably benign	0.03
R2441:Trpc4	UTSW	3	54222283	missense	probably damaging	0.96
R2877:Trpc4	UTSW	3	54291340	missense	probably damaging	1.00
R3846:Trpc4	UTSW	3	54318012	missense	probably benign	0.22
R3931:Trpc4	UTSW	3	54318095	missense	probably damaging	1.00
R4854:Trpc4	UTSW	3	54302218	missense	probably damaging	1.00
R5024:Trpc4	UTSW	3	54194796	missense	probably benign	0.11
R5284:Trpc4	UTSW	3	54279947	missense	probably damaging	0.99
R5320:Trpc4	UTSW	3	54299178	missense	probably damaging	0.99
R5973:Trpc4	UTSW	3	54315842	missense	probably damaging	1.00
R6276:Trpc4	UTSW	3	54318020	missense	probably benign	0.25
R6335:Trpc4	UTSW	3	54317574	critical splice donor site	probably null
R7082:Trpc4	UTSW	3	54299098	nonsense	probably null
R7215:Trpc4	UTSW	3	54194896	missense	possibly damaging	0.83
R7299:Trpc4	UTSW	3	54317627	missense	possibly damaging	0.87
R7423:Trpc4	UTSW	3	54318029	missense	probably benign
R7459:Trpc4	UTSW	3	54291232	missense	probably damaging	0.97
R7538:Trpc4	UTSW	3	54318095	missense	possibly damaging	0.92
R7542:Trpc4	UTSW	3	54315654	missense	probably damaging	1.00
R7823:Trpc4	UTSW	3	54302219	nonsense	probably null
R7868:Trpc4	UTSW	3	54302286	missense	probably benign	0.00
R8046:Trpc4	UTSW	3	54194914	missense	probably damaging	1.00
R8164:Trpc4	UTSW	3	54315805	missense	probably benign	0.31
R8235:Trpc4	UTSW	3	54302248	missense	probably benign	0.01
R8263:Trpc4	UTSW	3	54222335	missense	probably damaging	0.99
R8438:Trpc4	UTSW	3	54222253	missense	possibly damaging	0.90
R8854:Trpc4	UTSW	3	54194701	nonsense	probably null
R8987:Trpc4	UTSW	3	54194711	missense	probably benign	0.09
R9023:Trpc4	UTSW	3	54194833	missense	possibly damaging	0.52
R9196:Trpc4	UTSW	3	54222451	missense	probably damaging	1.00
R9210:Trpc4	UTSW	3	54266320	missense	probably benign	0.07
R9350:Trpc4	UTSW	3	54302189	missense	probably damaging	1.00
R9600:Trpc4	UTSW	3	54194827	nonsense	probably null
R9605:Trpc4	UTSW	3	54318129	missense	probably benign
R9644:Trpc4	UTSW	3	54222278	missense	probably damaging	1.00
R9749:Trpc4	UTSW	3	54194881	missense	probably damaging	1.00
R9755:Trpc4	UTSW	3	54315794	missense	probably damaging	1.00
X0066:Trpc4	UTSW	3	54194750	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGCCTGAAGCATGGCTCAGTTC -3'
(R):5'- TGCTTGTTTCCAACAACAGTCGCTC -3'

Sequencing Primer
(F):5'- CTGAAGCATGGCTCAGTTCTATTAC -3'
(R):5'- Tacacacacacacacacacac -3'

Posted On

2014-05-23