Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Abca4'

193178

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

MMRRC Submission

039795-MU

Accession Numbers

Genbank: NM_007378; MGI: 109424

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1763 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122163830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 772 (T772S)

Ref Sequence

ENSEMBL: ENSMUSP00000143560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]

AlphaFold

O35600

Predicted Effect

probably damaging
Transcript: ENSMUST00000013995
AA Change: T1980S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: T1980S

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137616

Predicted Effect

probably damaging
Transcript: ENSMUST00000141135
AA Change: T772S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: T772S

Domain	Start	End	E-Value	Type
Blast:AAA	1	172	9e-78	BLAST
Pfam:ABC2_membrane_3	311	686	1.9e-42	PFAM
AAA	755	939	1.2e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144949

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198484

Meta Mutation Damage Score

0.6866

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4668:Abca4	UTSW	3	122155299	missense	possibly damaging	0.90
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4795:Abca4	UTSW	3	122176123	missense	probably damaging	0.99
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6681:Abca4	UTSW	3	122121798	missense	probably damaging	1.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7758:Abca4	UTSW	3	122128167	missense	probably damaging	1.00
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
R9464:Abca4	UTSW	3	122120065	missense	probably benign	0.08
R9483:Abca4	UTSW	3	122085626	missense
R9751:Abca4	UTSW	3	122087477	missense	probably benign	0.00
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CCTCTGACCAGAGCTTGACAGTAGAAAT -3'
(R):5'- TATGACACTGGATGGCTTTCCACATGC -3'

Sequencing Primer
(F):5'- gaacccaagactaccagcc -3'
(R):5'- TTTCCACATGCTAGGACAAGG -3'

Posted On

2014-05-23