Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Cad'

193185

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

MMRRC Submission

039795-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31054780-31078479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31060951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 460 (V460I)

Ref Sequence

ENSEMBL: ENSMUSP00000144009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000201838] [ENSMUST00000202795]

AlphaFold

B2RQC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000013773
AA Change: V460I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: V460I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000200953
AA Change: V460I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: V460I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201182
AA Change: V460I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: V460I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201838
AA Change: V460I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: V460I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	6.3e-48	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	3.7e-86	PFAM
Pfam:ATP-grasp	522	690	2.5e-10	PFAM
Pfam:Dala_Dala_lig_C	526	687	4.2e-11	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
SCOP:d1a9xa3	935	964	1e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201844

Predicted Effect

probably damaging
Transcript: ENSMUST00000202795
AA Change: V460I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: V460I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202967

Meta Mutation Damage Score

0.4634

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31061484	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31059054	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31061770	splice site	probably benign
IGL01638:Cad	APN	5	31067614	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31060826	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31069604	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31055294	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31054986	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31072094	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31078110	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31072321	missense	probably benign	0.01
R0335:Cad	UTSW	5	31073985	unclassified	probably benign
R0401:Cad	UTSW	5	31073986	unclassified	probably benign
R0445:Cad	UTSW	5	31072709	missense	probably benign	0.08
R0494:Cad	UTSW	5	31077512	unclassified	probably benign
R0532:Cad	UTSW	5	31062187	splice site	probably benign
R0539:Cad	UTSW	5	31075457	splice site	probably benign
R0578:Cad	UTSW	5	31058776	missense	probably benign	0.01
R0590:Cad	UTSW	5	31062231	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31077688	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31067600	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31059582	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31068762	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31076219	missense	probably benign	0.14
R1785:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31062220	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31061674	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31074137	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31075546	splice site	probably null
R3847:Cad	UTSW	5	31061650	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31074022	missense	probably benign	0.06
R3943:Cad	UTSW	5	31072385	critical splice donor site	probably null
R4213:Cad	UTSW	5	31072344	missense	probably benign	0.01
R4458:Cad	UTSW	5	31061226	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31058133	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31070295	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31066686	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31074690	missense	probably benign	0.02
R5044:Cad	UTSW	5	31055021	missense	probably benign	0.00
R5630:Cad	UTSW	5	31060573	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31076847	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31069112	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31054983	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31062562	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31072978	missense	probably benign	0.00
R6260:Cad	UTSW	5	31066800	missense	probably null
R7145:Cad	UTSW	5	31067612	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31060213	critical splice donor site	probably null
R7352:Cad	UTSW	5	31058078	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31075829	missense	probably benign
R7387:Cad	UTSW	5	31061940	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31074162	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31069048	missense	probably benign
R7627:Cad	UTSW	5	31060164	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31061485	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31068806	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31060927	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31075821	missense	probably benign	0.00
R8523:Cad	UTSW	5	31058106	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31075156	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31074601	missense	probably benign	0.06
R8698:Cad	UTSW	5	31077475	missense	probably benign
R8699:Cad	UTSW	5	31076261	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31069564	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31067665	missense	probably null
R9272:Cad	UTSW	5	31061232	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31072656	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31077644	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31070674	critical splice donor site	probably null
R9665:Cad	UTSW	5	31072359	missense	probably benign	0.28
RF001:Cad	UTSW	5	31060212	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31060212	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31068131	missense	probably null	1.00
X0022:Cad	UTSW	5	31072317	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31068421	missense	probably damaging	1.00
Z1177:Cad	UTSW	5	31075128	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CGCCTCCACGAAAGGTTCTAATCC -3'
(R):5'- CAGTCAGTTCAATGGTCTCCACGG -3'

Sequencing Primer
(F):5'- AAGAAGTGCCTAAGTCCTGTC -3'
(R):5'- CGTTCATTACGAATTACCTGAGGC -3'

Posted On

2014-05-23