Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Adamts17'

193201

Institutional Source

Beutler Lab

Gene Symbol

Adamts17

Ensembl Gene

ENSMUSG00000058145

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17

Synonyms

AU023434

MMRRC Submission

039795-MU

Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R1763 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

66839735-67153171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67147715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1060 (N1060S)

Ref Sequence

ENSEMBL: ENSMUSP00000095984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]

AlphaFold

E9Q4D1

Predicted Effect

probably damaging
Transcript: ENSMUST00000098382
AA Change: N1060S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: N1060S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107478
AA Change: N1033S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: N1033S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Meta Mutation Damage Score

0.2898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Adamts17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Adamts17	APN	7	66968902	missense	probably damaging	1.00
IGL00950:Adamts17	APN	7	67120912	missense	possibly damaging	0.69
IGL01532:Adamts17	APN	7	66908601	missense	probably damaging	1.00
IGL01591:Adamts17	APN	7	67004396	missense	probably damaging	1.00
IGL01602:Adamts17	APN	7	66888411	missense	probably benign	0.29
IGL01640:Adamts17	APN	7	67029680	missense	probably damaging	0.98
IGL01686:Adamts17	APN	7	66840289	missense	probably benign	0.06
IGL01747:Adamts17	APN	7	67052011	missense	probably damaging	1.00
IGL02081:Adamts17	APN	7	67062110	missense	probably damaging	1.00
IGL02152:Adamts17	APN	7	67125000	missense	probably benign	0.01
IGL02264:Adamts17	APN	7	67047459	splice site	probably null
IGL02457:Adamts17	APN	7	67027814	missense	probably damaging	0.99
IGL02519:Adamts17	APN	7	67124973	missense	possibly damaging	0.82
IGL02530:Adamts17	APN	7	66909376	missense	probably damaging	1.00
IGL02649:Adamts17	APN	7	66849878	splice site	probably benign
IGL02711:Adamts17	APN	7	67052040	splice site	probably benign
IGL03006:Adamts17	APN	7	67078347	missense	possibly damaging	0.53
IGL03203:Adamts17	APN	7	67062108	missense	probably damaging	1.00
IGL03343:Adamts17	APN	7	67075316	missense	probably damaging	1.00
BB007:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
BB017:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
E2594:Adamts17	UTSW	7	67004350	missense	probably damaging	1.00
R0380:Adamts17	UTSW	7	67150044	missense	probably benign	0.00
R0416:Adamts17	UTSW	7	66915898	splice site	probably null
R0635:Adamts17	UTSW	7	66908605	missense	probably damaging	1.00
R1083:Adamts17	UTSW	7	67147574	missense	probably damaging	1.00
R1476:Adamts17	UTSW	7	67075343	missense	probably damaging	1.00
R1728:Adamts17	UTSW	7	67149956	nonsense	probably null
R1729:Adamts17	UTSW	7	67149956	nonsense	probably null
R1784:Adamts17	UTSW	7	67149956	nonsense	probably null
R1905:Adamts17	UTSW	7	67047472	nonsense	probably null
R1938:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3106:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3796:Adamts17	UTSW	7	66839914	splice site	probably null
R3849:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3850:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3945:Adamts17	UTSW	7	67120939	missense	probably benign
R4519:Adamts17	UTSW	7	66840566	missense	probably damaging	0.99
R4554:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4555:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4556:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4557:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4700:Adamts17	UTSW	7	67041888	missense	probably damaging	1.00
R4752:Adamts17	UTSW	7	67004470	missense	probably damaging	0.96
R5019:Adamts17	UTSW	7	67062070	nonsense	probably null
R5438:Adamts17	UTSW	7	66888417	missense	probably benign	0.30
R5444:Adamts17	UTSW	7	67041899	missense	probably benign	0.02
R5673:Adamts17	UTSW	7	67041807	missense	probably damaging	1.00
R6326:Adamts17	UTSW	7	67120888	missense	probably benign	0.05
R6964:Adamts17	UTSW	7	66909400	missense	possibly damaging	0.93
R6964:Adamts17	UTSW	7	67004353	missense	probably benign	0.00
R7129:Adamts17	UTSW	7	67121010	missense	probably damaging	1.00
R7317:Adamts17	UTSW	7	66840556	nonsense	probably null
R7355:Adamts17	UTSW	7	67075304	missense
R7386:Adamts17	UTSW	7	66968849	missense	probably benign	0.25
R7407:Adamts17	UTSW	7	67047556	nonsense	probably null
R7432:Adamts17	UTSW	7	67051917	missense
R7782:Adamts17	UTSW	7	67125054	missense	probably damaging	1.00
R7817:Adamts17	UTSW	7	66909476	missense	probably damaging	0.99
R7930:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
R7993:Adamts17	UTSW	7	66849864	missense	possibly damaging	0.90
R8178:Adamts17	UTSW	7	66849716	missense	possibly damaging	0.46
R8962:Adamts17	UTSW	7	67075309	missense	probably damaging	1.00
R9095:Adamts17	UTSW	7	67004369	missense	probably damaging	1.00
R9111:Adamts17	UTSW	7	66839900	missense	probably damaging	0.96
R9303:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9305:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9505:Adamts17	UTSW	7	67124935	missense	probably benign	0.00
R9668:Adamts17	UTSW	7	67147690	missense	possibly damaging	0.61
X0022:Adamts17	UTSW	7	67041901	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TCCTTGACATGCAGATATTGTGGGC -3'
(R):5'- GGGGATGGTCAAACACCTCTGAAC -3'

Sequencing Primer
(F):5'- GTCAGGTCACAGACCCTCAG -3'
(R):5'- ACCTTCTTCAGCCCTAGCAAATG -3'

Posted On

2014-05-23