Incidental Mutation 'R1763:Lmnb2'
ID 193209
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1763 (G1)
Quality Score 89
Status Validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80907191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 193 (L193Q)
Ref Sequence ENSEMBL: ENSMUSP00000136524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000179022]
AlphaFold P21619
Predicted Effect probably damaging
Transcript: ENSMUST00000057623
AA Change: L212Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: L212Q

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159094
Predicted Effect probably damaging
Transcript: ENSMUST00000179022
AA Change: L193Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: L193Q

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Meta Mutation Damage Score 0.6481 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,163,830 (GRCm38) T772S probably damaging Het
Abca4 G A 3: 122,110,681 (GRCm38) V794M probably benign Het
Acox3 G A 5: 35,608,339 (GRCm38) probably null Het
Adamts17 A G 7: 67,147,715 (GRCm38) N1060S probably damaging Het
Akap8l C T 17: 32,332,483 (GRCm38) R511H probably damaging Het
Als2 T C 1: 59,174,991 (GRCm38) Y1346C probably benign Het
Apol10b A T 15: 77,585,015 (GRCm38) F321I probably benign Het
Atp5f1 A G 3: 105,951,589 (GRCm38) probably null Het
Bloc1s5 A G 13: 38,619,084 (GRCm38) probably benign Het
Btbd9 T C 17: 30,334,297 (GRCm38) N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 (GRCm38) V1121A probably benign Het
Cad G A 5: 31,060,951 (GRCm38) V460I probably damaging Het
Caprin2 A T 6: 148,843,121 (GRCm38) D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 (GRCm38) K686N probably benign Het
Ccnt2 T C 1: 127,799,406 (GRCm38) F186L possibly damaging Het
Cd5l G A 3: 87,367,880 (GRCm38) probably null Het
Chrna7 A G 7: 63,099,252 (GRCm38) V494A probably benign Het
Clec2i T G 6: 128,895,425 (GRCm38) Y198* probably null Het
Col22a1 A G 15: 72,007,176 (GRCm38) V44A probably damaging Het
Cspg4 T A 9: 56,886,979 (GRCm38) I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 (GRCm38) probably null Het
Dlk1 G T 12: 109,458,119 (GRCm38) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 (GRCm38) probably benign Het
Dscc1 T A 15: 55,084,139 (GRCm38) H215L probably damaging Het
Dus1l C G 11: 120,795,671 (GRCm38) G15R probably benign Het
Eps8l1 G T 7: 4,471,823 (GRCm38) V268L probably benign Het
F2 A C 2: 91,634,906 (GRCm38) C104W probably damaging Het
F5 C A 1: 164,192,535 (GRCm38) Q860K probably benign Het
Fmn2 T C 1: 174,502,266 (GRCm38) L74P unknown Het
Frmd6 G A 12: 70,893,622 (GRCm38) R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 (GRCm38) S158A probably damaging Het
Galc T C 12: 98,234,266 (GRCm38) N295S probably damaging Het
Gm436 A G 4: 144,669,959 (GRCm38) V401A probably benign Het
Gm6408 A T 5: 146,482,322 (GRCm38) N49I probably damaging Het
Grm1 T A 10: 11,079,866 (GRCm38) T225S possibly damaging Het
Grm8 C T 6: 27,285,867 (GRCm38) V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 (GRCm38) D59G probably damaging Het
Iars G A 13: 49,723,077 (GRCm38) probably null Het
Ifi27 C T 12: 103,437,682 (GRCm38) A127V possibly damaging Het
Ikbip A G 10: 91,096,481 (GRCm38) N329S probably damaging Het
Ikbke T C 1: 131,265,877 (GRCm38) T479A probably benign Het
Krt12 T A 11: 99,416,060 (GRCm38) N472I probably damaging Het
Lrriq4 T C 3: 30,650,252 (GRCm38) V128A probably benign Het
Map4k4 C A 1: 40,000,757 (GRCm38) probably benign Het
Mtmr7 T C 8: 40,551,811 (GRCm38) T575A probably benign Het
Myh13 G A 11: 67,334,576 (GRCm38) A256T probably benign Het
Napepld A G 5: 21,683,410 (GRCm38) Y14H probably benign Het
Npr1 T C 3: 90,459,337 (GRCm38) T552A probably damaging Het
Nudt15 A G 14: 73,521,647 (GRCm38) F127S probably benign Het
Nwd2 T A 5: 63,808,271 (GRCm38) S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 (GRCm38) I211V probably benign Het
Olfr1257 G A 2: 89,881,129 (GRCm38) G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 (GRCm38) I262L probably benign Het
Olfr907 A G 9: 38,499,038 (GRCm38) Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 (GRCm38) F102L probably benign Het
Paqr7 A T 4: 134,507,098 (GRCm38) I89F probably benign Het
Pidd1 C A 7: 141,439,630 (GRCm38) V706L probably benign Het
Polr3c A T 3: 96,713,595 (GRCm38) I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 (GRCm38) Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 (GRCm38) T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 (GRCm38) I753L probably benign Het
Rad21 T C 15: 51,978,170 (GRCm38) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm38) E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 (GRCm38) R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 (GRCm38) R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 (GRCm38) D1449G probably damaging Het
Sema4g C T 19: 45,001,605 (GRCm38) R708* probably null Het
Sept9 T C 11: 117,290,428 (GRCm38) I18T probably benign Het
Serpinb6b A G 13: 32,978,058 (GRCm38) E280G probably damaging Het
Slamf6 T C 1: 171,942,587 (GRCm38) probably benign Het
Slc6a21 G A 7: 45,287,734 (GRCm38) W554* probably null Het
Slco1a4 A C 6: 141,812,731 (GRCm38) I518R probably benign Het
Stab1 T A 14: 31,168,416 (GRCm38) Q26L probably benign Het
Stox1 A G 10: 62,667,965 (GRCm38) F104L probably damaging Het
Suco T C 1: 161,834,949 (GRCm38) K638E possibly damaging Het
Synpo T C 18: 60,602,784 (GRCm38) K458E probably damaging Het
Szt2 A T 4: 118,372,368 (GRCm38) W2820R unknown Het
Tmtc1 C A 6: 148,294,618 (GRCm38) G499W probably damaging Het
Tonsl A C 15: 76,638,066 (GRCm38) S242R probably damaging Het
Trpc4 G T 3: 54,194,822 (GRCm38) S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 (GRCm38) R1581C probably benign Het
Zfp27 A G 7: 29,895,376 (GRCm38) L388P possibly damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80,904,037 (GRCm38) missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80,909,987 (GRCm38) missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80,904,984 (GRCm38) missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80,907,165 (GRCm38) missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80,906,254 (GRCm38) start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80,904,315 (GRCm38) unclassified probably benign
R1324:Lmnb2 UTSW 10 80,904,171 (GRCm38) missense possibly damaging 0.60
R2229:Lmnb2 UTSW 10 80,904,392 (GRCm38) unclassified probably benign
R5001:Lmnb2 UTSW 10 80,918,112 (GRCm38) missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80,904,655 (GRCm38) missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80,903,957 (GRCm38) missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80,906,087 (GRCm38) missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80,905,128 (GRCm38) nonsense probably null
R6314:Lmnb2 UTSW 10 80,909,970 (GRCm38) missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80,909,960 (GRCm38) missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80,904,739 (GRCm38) missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80,918,157 (GRCm38) missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80,905,148 (GRCm38) missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80,905,079 (GRCm38) critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80,904,257 (GRCm38) missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80,906,171 (GRCm38) missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80,904,257 (GRCm38) missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80,903,238 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACTGGAGTCTGTCTGCCCACC -3'
(R):5'- AGCTCCCTAGTGACATGGAGAAGC -3'

Sequencing Primer
(F):5'- TCAAACACACTCTGACCCTG -3'
(R):5'- CTAGTGACATGGAGAAGCTGAATTG -3'
Posted On 2014-05-23