Incidental Mutation 'R1763:Myh13'
ID193211
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 039795-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1763 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67334576 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 256 (A256T)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: A256T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: A256T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: A256T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: A256T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: A256T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: A256T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCAAGCAGAGAGTCAGCGAGTG -3'
(R):5'- GAGAGCCTTTAACACCTCAGGCAG -3'

Sequencing Primer
(F):5'- ATTCTCAGAACCTTGGAGGAC -3'
(R):5'- ACCTCAGGCAGTGTTAAGTC -3'
Posted On2014-05-23