Incidental Mutation 'R1763:Septin9'
ID 193213
Institutional Source Beutler Lab
Gene Symbol Septin9
Ensembl Gene ENSMUSG00000059248
Gene Name septin 9
Synonyms Msf, Sept9, MSF1, PNUTL4, SL3-3 integration site 1, Sint1
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1763 (G1)
Quality Score 180
Status Validated
Chromosome 11
Chromosomal Location 117090487-117253151 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117181254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 18 (I18T)
Ref Sequence ENSEMBL: ENSMUSP00000101961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000106354]
AlphaFold Q80UG5
Predicted Effect probably benign
Transcript: ENSMUST00000019038
AA Change: I29T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: I29T

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093907
AA Change: I36T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: I36T

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106354
AA Change: I18T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: I18T

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,529 (GRCm39) V401A probably benign Het
Abca4 G A 3: 121,904,330 (GRCm39) V794M probably benign Het
Abca4 A T 3: 121,957,479 (GRCm39) T772S probably damaging Het
Acox3 G A 5: 35,765,683 (GRCm39) probably null Het
Adamts17 A G 7: 66,797,463 (GRCm39) N1060S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Als2 T C 1: 59,214,150 (GRCm39) Y1346C probably benign Het
Apol10b A T 15: 77,469,215 (GRCm39) F321I probably benign Het
Atp5pb A G 3: 105,858,905 (GRCm39) probably null Het
Bloc1s5 A G 13: 38,803,060 (GRCm39) probably benign Het
Btbd9 T C 17: 30,553,271 (GRCm39) N397S possibly damaging Het
Cacna1d A G 14: 29,821,153 (GRCm39) V1121A probably benign Het
Cad G A 5: 31,218,295 (GRCm39) V460I probably damaging Het
Caprin2 A T 6: 148,744,619 (GRCm39) D935E probably damaging Het
Ccdc150 A T 1: 54,393,795 (GRCm39) K686N probably benign Het
Ccnt2 T C 1: 127,727,143 (GRCm39) F186L possibly damaging Het
Cd5l G A 3: 87,275,187 (GRCm39) probably null Het
Chrna7 A G 7: 62,749,000 (GRCm39) V494A probably benign Het
Clec2i T G 6: 128,872,388 (GRCm39) Y198* probably null Het
Col22a1 A G 15: 71,879,025 (GRCm39) V44A probably damaging Het
Cspg4 T A 9: 56,794,263 (GRCm39) I666N probably damaging Het
Cyp3a16 A T 5: 145,401,841 (GRCm39) probably null Het
Dlk1 G T 12: 109,424,045 (GRCm39) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 54,943,572 (GRCm39) probably benign Het
Dscc1 T A 15: 54,947,535 (GRCm39) H215L probably damaging Het
Dus1l C G 11: 120,686,497 (GRCm39) G15R probably benign Het
Eps8l1 G T 7: 4,474,822 (GRCm39) V268L probably benign Het
F2 A C 2: 91,465,251 (GRCm39) C104W probably damaging Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fmn2 T C 1: 174,329,832 (GRCm39) L74P unknown Het
Frmd6 G A 12: 70,940,396 (GRCm39) R347Q possibly damaging Het
Gabbr1 T G 17: 37,365,659 (GRCm39) S158A probably damaging Het
Galc T C 12: 98,200,525 (GRCm39) N295S probably damaging Het
Gm6408 A T 5: 146,419,132 (GRCm39) N49I probably damaging Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Grm8 C T 6: 27,285,866 (GRCm39) V849I possibly damaging Het
Hmcn2 A G 2: 31,204,602 (GRCm39) D59G probably damaging Het
Iars1 G A 13: 49,876,553 (GRCm39) probably null Het
Ifi27l2a C T 12: 103,403,941 (GRCm39) A127V possibly damaging Het
Ikbip A G 10: 90,932,343 (GRCm39) N329S probably damaging Het
Ikbke T C 1: 131,193,614 (GRCm39) T479A probably benign Het
Krt12 T A 11: 99,306,886 (GRCm39) N472I probably damaging Het
Lmnb2 A T 10: 80,743,025 (GRCm39) L193Q probably damaging Het
Lrriq4 T C 3: 30,704,401 (GRCm39) V128A probably benign Het
Map4k4 C A 1: 40,039,917 (GRCm39) probably benign Het
Mtmr7 T C 8: 41,004,852 (GRCm39) T575A probably benign Het
Myh13 G A 11: 67,225,402 (GRCm39) A256T probably benign Het
Napepld A G 5: 21,888,408 (GRCm39) Y14H probably benign Het
Npr1 T C 3: 90,366,644 (GRCm39) T552A probably damaging Het
Nudt15 A G 14: 73,759,087 (GRCm39) F127S probably benign Het
Nwd2 T A 5: 63,965,614 (GRCm39) S1733T probably benign Het
Or11a4 T C 17: 37,536,321 (GRCm39) F102L probably benign Het
Or4c102 A G 2: 88,422,780 (GRCm39) I211V probably benign Het
Or4c10b G A 2: 89,711,473 (GRCm39) G101E probably damaging Het
Or6z1 T G 7: 6,504,440 (GRCm39) I262L probably benign Het
Or8b44 A G 9: 38,410,334 (GRCm39) Y123C probably damaging Het
Paqr7 A T 4: 134,234,409 (GRCm39) I89F probably benign Het
Pidd1 C A 7: 141,019,543 (GRCm39) V706L probably benign Het
Polr3c A T 3: 96,620,911 (GRCm39) I469N probably damaging Het
Ppip5k1 A G 2: 121,179,028 (GRCm39) Y233H probably damaging Het
Psmc3 A G 2: 90,886,340 (GRCm39) T166A possibly damaging Het
Ptchd3 A T 11: 121,733,368 (GRCm39) I753L probably benign Het
Rad21 T C 15: 51,841,566 (GRCm39) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm39) E479G possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rgs20 C T 1: 4,980,863 (GRCm39) R154Q probably damaging Het
Sbf1 T C 15: 89,178,628 (GRCm39) D1449G probably damaging Het
Sema4g C T 19: 44,990,044 (GRCm39) R708* probably null Het
Serpinb6b A G 13: 33,162,041 (GRCm39) E280G probably damaging Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc6a21 G A 7: 44,937,158 (GRCm39) W554* probably null Het
Slco1a4 A C 6: 141,758,457 (GRCm39) I518R probably benign Het
Stab1 T A 14: 30,890,373 (GRCm39) Q26L probably benign Het
Stox1 A G 10: 62,503,744 (GRCm39) F104L probably damaging Het
Suco T C 1: 161,662,518 (GRCm39) K638E possibly damaging Het
Synpo T C 18: 60,735,856 (GRCm39) K458E probably damaging Het
Szt2 A T 4: 118,229,565 (GRCm39) W2820R unknown Het
Tmtc1 C A 6: 148,196,116 (GRCm39) G499W probably damaging Het
Tonsl A C 15: 76,522,266 (GRCm39) S242R probably damaging Het
Trpc4 G T 3: 54,102,243 (GRCm39) S47I possibly damaging Het
Zfp106 G A 2: 120,350,909 (GRCm39) R1581C probably benign Het
Zfp27 A G 7: 29,594,801 (GRCm39) L388P possibly damaging Het
Other mutations in Septin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Septin9 APN 11 117,243,010 (GRCm39) missense probably damaging 1.00
IGL00230:Septin9 APN 11 117,245,630 (GRCm39) unclassified probably benign
IGL01520:Septin9 APN 11 117,243,469 (GRCm39) missense probably damaging 1.00
IGL01905:Septin9 APN 11 117,109,715 (GRCm39) missense probably benign 0.07
IGL02502:Septin9 APN 11 117,181,488 (GRCm39) missense probably damaging 1.00
R0325:Septin9 UTSW 11 117,247,458 (GRCm39) missense probably damaging 0.99
R0825:Septin9 UTSW 11 117,250,286 (GRCm39) missense probably damaging 1.00
R0845:Septin9 UTSW 11 117,247,151 (GRCm39) unclassified probably benign
R1581:Septin9 UTSW 11 117,181,421 (GRCm39) missense probably damaging 1.00
R1848:Septin9 UTSW 11 117,243,909 (GRCm39) unclassified probably benign
R2039:Septin9 UTSW 11 117,242,443 (GRCm39) missense probably damaging 1.00
R2409:Septin9 UTSW 11 117,251,287 (GRCm39) missense probably damaging 1.00
R2763:Septin9 UTSW 11 117,217,327 (GRCm39) missense probably benign 0.05
R3545:Septin9 UTSW 11 117,243,499 (GRCm39) missense probably damaging 1.00
R4062:Septin9 UTSW 11 117,243,091 (GRCm39) missense probably damaging 1.00
R4601:Septin9 UTSW 11 117,251,310 (GRCm39) missense probably damaging 1.00
R5139:Septin9 UTSW 11 117,247,511 (GRCm39) missense possibly damaging 0.80
R5759:Septin9 UTSW 11 117,243,094 (GRCm39) missense probably benign 0.15
R6062:Septin9 UTSW 11 117,181,626 (GRCm39) missense possibly damaging 0.89
R6134:Septin9 UTSW 11 117,242,987 (GRCm39) missense probably damaging 1.00
R6509:Septin9 UTSW 11 117,181,253 (GRCm39) missense probably benign
R7562:Septin9 UTSW 11 117,217,337 (GRCm39) critical splice donor site probably null
R7573:Septin9 UTSW 11 117,090,571 (GRCm39) start gained probably benign
R7592:Septin9 UTSW 11 117,181,488 (GRCm39) missense probably damaging 1.00
R7810:Septin9 UTSW 11 117,250,264 (GRCm39) nonsense probably null
R8200:Septin9 UTSW 11 117,123,542 (GRCm39) missense probably benign 0.01
R9118:Septin9 UTSW 11 117,157,398 (GRCm39) missense probably benign
R9131:Septin9 UTSW 11 117,181,460 (GRCm39) missense probably damaging 1.00
R9220:Septin9 UTSW 11 117,242,396 (GRCm39) missense probably benign 0.05
R9241:Septin9 UTSW 11 117,109,724 (GRCm39) missense probably benign 0.00
R9661:Septin9 UTSW 11 117,245,751 (GRCm39) missense possibly damaging 0.91
R9735:Septin9 UTSW 11 117,245,680 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGGCAAATACTGCACCACTGAG -3'
(R):5'- CTTGACAATGGTGATCTCCGTCCTC -3'

Sequencing Primer
(F):5'- ctggctttgaacttggtgtg -3'
(R):5'- AGATCTCTGTGCGTCGAGAC -3'
Posted On 2014-05-23