Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Sept9'

193213

Institutional Source

Beutler Lab

Gene Symbol

Sept9

Ensembl Gene

ENSMUSG00000059248

Gene Name

septin 9

Synonyms

PNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1

MMRRC Submission

039795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1763 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

117199661-117362325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117290428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 18 (I18T)

Ref Sequence

ENSEMBL: ENSMUSP00000101961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000106354]

AlphaFold

Q80UG5

Predicted Effect

probably benign
Transcript: ENSMUST00000019038
AA Change: I29T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: I29T

Domain	Start	End	E-Value	Type
Pfam:DUF258	265	379	5.3e-8	PFAM
Pfam:Septin	286	565	1.2e-112	PFAM
Pfam:GTP_EFTU	289	365	1.5e-5	PFAM
Pfam:AIG1	290	379	3.1e-7	PFAM
Pfam:MMR_HSR1	291	481	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000093907
AA Change: I36T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: I36T

Domain	Start	End	E-Value	Type
Pfam:Septin	293	572	1.6e-112	PFAM
Pfam:MMR_HSR1	298	444	3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106354
AA Change: I18T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: I18T

Domain	Start	End	E-Value	Type
Pfam:DUF258	254	368	4.2e-8	PFAM
Pfam:Septin	275	554	3.4e-113	PFAM
Pfam:GTP_EFTU	278	354	3.7e-6	PFAM
Pfam:AIG1	279	368	1.9e-7	PFAM
Pfam:MMR_HSR1	280	378	7.6e-10	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Sept9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Sept9	APN	11	117352184	missense	probably damaging	1.00
IGL00230:Sept9	APN	11	117354804	unclassified	probably benign
IGL01520:Sept9	APN	11	117352643	missense	probably damaging	1.00
IGL01905:Sept9	APN	11	117218889	missense	probably benign	0.07
IGL02502:Sept9	APN	11	117290662	missense	probably damaging	1.00
R0325:Sept9	UTSW	11	117356632	missense	probably damaging	0.99
R0825:Sept9	UTSW	11	117359460	missense	probably damaging	1.00
R0845:Sept9	UTSW	11	117356325	unclassified	probably benign
R1581:Sept9	UTSW	11	117290595	missense	probably damaging	1.00
R1848:Sept9	UTSW	11	117353083	unclassified	probably benign
R2039:Sept9	UTSW	11	117351617	missense	probably damaging	1.00
R2409:Sept9	UTSW	11	117360461	missense	probably damaging	1.00
R2763:Sept9	UTSW	11	117326501	missense	probably benign	0.05
R3545:Sept9	UTSW	11	117352673	missense	probably damaging	1.00
R4062:Sept9	UTSW	11	117352265	missense	probably damaging	1.00
R4601:Sept9	UTSW	11	117360484	missense	probably damaging	1.00
R5139:Sept9	UTSW	11	117356685	missense	possibly damaging	0.80
R5759:Sept9	UTSW	11	117352268	missense	probably benign	0.15
R6062:Sept9	UTSW	11	117290800	missense	possibly damaging	0.89
R6134:Sept9	UTSW	11	117352161	missense	probably damaging	1.00
R6509:Sept9	UTSW	11	117290427	missense	probably benign
R7562:Sept9	UTSW	11	117326511	critical splice donor site	probably null
R7573:Sept9	UTSW	11	117199745	start gained	probably benign
R7592:Sept9	UTSW	11	117290662	missense	probably damaging	1.00
R7810:Sept9	UTSW	11	117359438	nonsense	probably null
R8200:Sept9	UTSW	11	117232716	missense	probably benign	0.01
R9118:Sept9	UTSW	11	117266572	missense	probably benign
R9131:Sept9	UTSW	11	117290634	missense	probably damaging	1.00
R9220:Sept9	UTSW	11	117351570	missense	probably benign	0.05
R9241:Sept9	UTSW	11	117218898	missense	probably benign	0.00
R9661:Sept9	UTSW	11	117354925	missense	possibly damaging	0.91
R9735:Sept9	UTSW	11	117354854	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTAGGCAAATACTGCACCACTGAG -3'
(R):5'- CTTGACAATGGTGATCTCCGTCCTC -3'

Sequencing Primer
(F):5'- ctggctttgaacttggtgtg -3'
(R):5'- AGATCTCTGTGCGTCGAGAC -3'

Posted On

2014-05-23