Incidental Mutation 'R1763:Dus1l'
ID 193214
Institutional Source Beutler Lab
Gene Symbol Dus1l
Ensembl Gene ENSMUSG00000025155
Gene Name dihydrouridine synthase 1-like (S. cerevisiae)
Synonyms 1110032N12Rik
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 120789201-120796403 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 120795671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 15 (G15R)
Ref Sequence ENSEMBL: ENSMUSP00000132516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026151] [ENSMUST00000106133] [ENSMUST00000106135] [ENSMUST00000129955] [ENSMUST00000143139] [ENSMUST00000167023]
AlphaFold Q8C2P3
Predicted Effect probably benign
Transcript: ENSMUST00000026151
AA Change: G15R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026151
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 314 5.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106133
AA Change: G15R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101739
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106135
AA Change: G15R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101741
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129955
AA Change: G15R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116619
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 166 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143139
AA Change: G15R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118773
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 194 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146008
Predicted Effect probably benign
Transcript: ENSMUST00000167023
AA Change: G15R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132516
Gene: ENSMUSG00000025155
AA Change: G15R

DomainStartEndE-ValueType
Pfam:Dus 20 322 1.6e-75 PFAM
low complexity region 360 371 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,163,830 (GRCm38) T772S probably damaging Het
Abca4 G A 3: 122,110,681 (GRCm38) V794M probably benign Het
Acox3 G A 5: 35,608,339 (GRCm38) probably null Het
Adamts17 A G 7: 67,147,715 (GRCm38) N1060S probably damaging Het
Akap8l C T 17: 32,332,483 (GRCm38) R511H probably damaging Het
Als2 T C 1: 59,174,991 (GRCm38) Y1346C probably benign Het
Apol10b A T 15: 77,585,015 (GRCm38) F321I probably benign Het
Atp5f1 A G 3: 105,951,589 (GRCm38) probably null Het
Bloc1s5 A G 13: 38,619,084 (GRCm38) probably benign Het
Btbd9 T C 17: 30,334,297 (GRCm38) N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 (GRCm38) V1121A probably benign Het
Cad G A 5: 31,060,951 (GRCm38) V460I probably damaging Het
Caprin2 A T 6: 148,843,121 (GRCm38) D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 (GRCm38) K686N probably benign Het
Ccnt2 T C 1: 127,799,406 (GRCm38) F186L possibly damaging Het
Cd5l G A 3: 87,367,880 (GRCm38) probably null Het
Chrna7 A G 7: 63,099,252 (GRCm38) V494A probably benign Het
Clec2i T G 6: 128,895,425 (GRCm38) Y198* probably null Het
Col22a1 A G 15: 72,007,176 (GRCm38) V44A probably damaging Het
Cspg4 T A 9: 56,886,979 (GRCm38) I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 (GRCm38) probably null Het
Dlk1 G T 12: 109,458,119 (GRCm38) C102F probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 (GRCm38) probably benign Het
Dscc1 T A 15: 55,084,139 (GRCm38) H215L probably damaging Het
Eps8l1 G T 7: 4,471,823 (GRCm38) V268L probably benign Het
F2 A C 2: 91,634,906 (GRCm38) C104W probably damaging Het
F5 C A 1: 164,192,535 (GRCm38) Q860K probably benign Het
Fmn2 T C 1: 174,502,266 (GRCm38) L74P unknown Het
Frmd6 G A 12: 70,893,622 (GRCm38) R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 (GRCm38) S158A probably damaging Het
Galc T C 12: 98,234,266 (GRCm38) N295S probably damaging Het
Gm436 A G 4: 144,669,959 (GRCm38) V401A probably benign Het
Gm6408 A T 5: 146,482,322 (GRCm38) N49I probably damaging Het
Grm1 T A 10: 11,079,866 (GRCm38) T225S possibly damaging Het
Grm8 C T 6: 27,285,867 (GRCm38) V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 (GRCm38) D59G probably damaging Het
Iars G A 13: 49,723,077 (GRCm38) probably null Het
Ifi27 C T 12: 103,437,682 (GRCm38) A127V possibly damaging Het
Ikbip A G 10: 91,096,481 (GRCm38) N329S probably damaging Het
Ikbke T C 1: 131,265,877 (GRCm38) T479A probably benign Het
Krt12 T A 11: 99,416,060 (GRCm38) N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 (GRCm38) L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 (GRCm38) V128A probably benign Het
Map4k4 C A 1: 40,000,757 (GRCm38) probably benign Het
Mtmr7 T C 8: 40,551,811 (GRCm38) T575A probably benign Het
Myh13 G A 11: 67,334,576 (GRCm38) A256T probably benign Het
Napepld A G 5: 21,683,410 (GRCm38) Y14H probably benign Het
Npr1 T C 3: 90,459,337 (GRCm38) T552A probably damaging Het
Nudt15 A G 14: 73,521,647 (GRCm38) F127S probably benign Het
Nwd2 T A 5: 63,808,271 (GRCm38) S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 (GRCm38) I211V probably benign Het
Olfr1257 G A 2: 89,881,129 (GRCm38) G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 (GRCm38) I262L probably benign Het
Olfr907 A G 9: 38,499,038 (GRCm38) Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 (GRCm38) F102L probably benign Het
Paqr7 A T 4: 134,507,098 (GRCm38) I89F probably benign Het
Pidd1 C A 7: 141,439,630 (GRCm38) V706L probably benign Het
Polr3c A T 3: 96,713,595 (GRCm38) I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 (GRCm38) Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 (GRCm38) T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 (GRCm38) I753L probably benign Het
Rad21 T C 15: 51,978,170 (GRCm38) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm38) E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 (GRCm38) R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 (GRCm38) R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 (GRCm38) D1449G probably damaging Het
Sema4g C T 19: 45,001,605 (GRCm38) R708* probably null Het
Sept9 T C 11: 117,290,428 (GRCm38) I18T probably benign Het
Serpinb6b A G 13: 32,978,058 (GRCm38) E280G probably damaging Het
Slamf6 T C 1: 171,942,587 (GRCm38) probably benign Het
Slc6a21 G A 7: 45,287,734 (GRCm38) W554* probably null Het
Slco1a4 A C 6: 141,812,731 (GRCm38) I518R probably benign Het
Stab1 T A 14: 31,168,416 (GRCm38) Q26L probably benign Het
Stox1 A G 10: 62,667,965 (GRCm38) F104L probably damaging Het
Suco T C 1: 161,834,949 (GRCm38) K638E possibly damaging Het
Synpo T C 18: 60,602,784 (GRCm38) K458E probably damaging Het
Szt2 A T 4: 118,372,368 (GRCm38) W2820R unknown Het
Tmtc1 C A 6: 148,294,618 (GRCm38) G499W probably damaging Het
Tonsl A C 15: 76,638,066 (GRCm38) S242R probably damaging Het
Trpc4 G T 3: 54,194,822 (GRCm38) S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 (GRCm38) R1581C probably benign Het
Zfp27 A G 7: 29,895,376 (GRCm38) L388P possibly damaging Het
Other mutations in Dus1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Dus1l APN 11 120,793,875 (GRCm38) missense probably damaging 1.00
IGL01338:Dus1l APN 11 120,793,092 (GRCm38) missense possibly damaging 0.95
IGL01538:Dus1l APN 11 120,793,079 (GRCm38) missense probably damaging 0.98
IGL03220:Dus1l APN 11 120,792,359 (GRCm38) missense probably damaging 1.00
R0076:Dus1l UTSW 11 120,792,808 (GRCm38) unclassified probably benign
R0076:Dus1l UTSW 11 120,792,808 (GRCm38) unclassified probably benign
R0893:Dus1l UTSW 11 120,789,436 (GRCm38) missense possibly damaging 0.92
R3149:Dus1l UTSW 11 120,793,104 (GRCm38) missense possibly damaging 0.93
R4175:Dus1l UTSW 11 120,795,680 (GRCm38) missense possibly damaging 0.94
R4753:Dus1l UTSW 11 120,792,075 (GRCm38) missense probably benign 0.21
R4816:Dus1l UTSW 11 120,789,758 (GRCm38) unclassified probably benign
R7056:Dus1l UTSW 11 120,791,294 (GRCm38) missense probably benign 0.35
R7808:Dus1l UTSW 11 120,789,436 (GRCm38) missense possibly damaging 0.92
R9323:Dus1l UTSW 11 120,793,898 (GRCm38) missense probably damaging 1.00
R9777:Dus1l UTSW 11 120,793,032 (GRCm38) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTCAGCTCACCTGCACAATGAGAG -3'
(R):5'- GTATGTCAGGGTCACTGCCAGAAAG -3'

Sequencing Primer
(F):5'- TGTAGCATAGGGGTGTAGCA -3'
(R):5'- ACCCTGTGCCTACGGATAC -3'
Posted On 2014-05-23