Incidental Mutation 'R1763:Dlk1'
ID 193219
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Name delta like non-canonical Notch ligand 1
Synonyms SCP1, pref-1, pG2, Peg9, ZOG, DlkI, FA1
MMRRC Submission 039795-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.657) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 109418749-109429262 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109424045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 102 (C102F)
Ref Sequence ENSEMBL: ENSMUSP00000133530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000056110
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109841
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109842
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109843
AA Change: C103F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109844
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109846
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124293
AA Change: C102F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856
AA Change: C102F

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173539
AA Change: C103F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856
AA Change: C103F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174539
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,529 (GRCm39) V401A probably benign Het
Abca4 G A 3: 121,904,330 (GRCm39) V794M probably benign Het
Abca4 A T 3: 121,957,479 (GRCm39) T772S probably damaging Het
Acox3 G A 5: 35,765,683 (GRCm39) probably null Het
Adamts17 A G 7: 66,797,463 (GRCm39) N1060S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Als2 T C 1: 59,214,150 (GRCm39) Y1346C probably benign Het
Apol10b A T 15: 77,469,215 (GRCm39) F321I probably benign Het
Atp5pb A G 3: 105,858,905 (GRCm39) probably null Het
Bloc1s5 A G 13: 38,803,060 (GRCm39) probably benign Het
Btbd9 T C 17: 30,553,271 (GRCm39) N397S possibly damaging Het
Cacna1d A G 14: 29,821,153 (GRCm39) V1121A probably benign Het
Cad G A 5: 31,218,295 (GRCm39) V460I probably damaging Het
Caprin2 A T 6: 148,744,619 (GRCm39) D935E probably damaging Het
Ccdc150 A T 1: 54,393,795 (GRCm39) K686N probably benign Het
Ccnt2 T C 1: 127,727,143 (GRCm39) F186L possibly damaging Het
Cd5l G A 3: 87,275,187 (GRCm39) probably null Het
Chrna7 A G 7: 62,749,000 (GRCm39) V494A probably benign Het
Clec2i T G 6: 128,872,388 (GRCm39) Y198* probably null Het
Col22a1 A G 15: 71,879,025 (GRCm39) V44A probably damaging Het
Cspg4 T A 9: 56,794,263 (GRCm39) I666N probably damaging Het
Cyp3a16 A T 5: 145,401,841 (GRCm39) probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 54,943,572 (GRCm39) probably benign Het
Dscc1 T A 15: 54,947,535 (GRCm39) H215L probably damaging Het
Dus1l C G 11: 120,686,497 (GRCm39) G15R probably benign Het
Eps8l1 G T 7: 4,474,822 (GRCm39) V268L probably benign Het
F2 A C 2: 91,465,251 (GRCm39) C104W probably damaging Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fmn2 T C 1: 174,329,832 (GRCm39) L74P unknown Het
Frmd6 G A 12: 70,940,396 (GRCm39) R347Q possibly damaging Het
Gabbr1 T G 17: 37,365,659 (GRCm39) S158A probably damaging Het
Galc T C 12: 98,200,525 (GRCm39) N295S probably damaging Het
Gm6408 A T 5: 146,419,132 (GRCm39) N49I probably damaging Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Grm8 C T 6: 27,285,866 (GRCm39) V849I possibly damaging Het
Hmcn2 A G 2: 31,204,602 (GRCm39) D59G probably damaging Het
Iars1 G A 13: 49,876,553 (GRCm39) probably null Het
Ifi27l2a C T 12: 103,403,941 (GRCm39) A127V possibly damaging Het
Ikbip A G 10: 90,932,343 (GRCm39) N329S probably damaging Het
Ikbke T C 1: 131,193,614 (GRCm39) T479A probably benign Het
Krt12 T A 11: 99,306,886 (GRCm39) N472I probably damaging Het
Lmnb2 A T 10: 80,743,025 (GRCm39) L193Q probably damaging Het
Lrriq4 T C 3: 30,704,401 (GRCm39) V128A probably benign Het
Map4k4 C A 1: 40,039,917 (GRCm39) probably benign Het
Mtmr7 T C 8: 41,004,852 (GRCm39) T575A probably benign Het
Myh13 G A 11: 67,225,402 (GRCm39) A256T probably benign Het
Napepld A G 5: 21,888,408 (GRCm39) Y14H probably benign Het
Npr1 T C 3: 90,366,644 (GRCm39) T552A probably damaging Het
Nudt15 A G 14: 73,759,087 (GRCm39) F127S probably benign Het
Nwd2 T A 5: 63,965,614 (GRCm39) S1733T probably benign Het
Or11a4 T C 17: 37,536,321 (GRCm39) F102L probably benign Het
Or4c102 A G 2: 88,422,780 (GRCm39) I211V probably benign Het
Or4c10b G A 2: 89,711,473 (GRCm39) G101E probably damaging Het
Or6z1 T G 7: 6,504,440 (GRCm39) I262L probably benign Het
Or8b44 A G 9: 38,410,334 (GRCm39) Y123C probably damaging Het
Paqr7 A T 4: 134,234,409 (GRCm39) I89F probably benign Het
Pidd1 C A 7: 141,019,543 (GRCm39) V706L probably benign Het
Polr3c A T 3: 96,620,911 (GRCm39) I469N probably damaging Het
Ppip5k1 A G 2: 121,179,028 (GRCm39) Y233H probably damaging Het
Psmc3 A G 2: 90,886,340 (GRCm39) T166A possibly damaging Het
Ptchd3 A T 11: 121,733,368 (GRCm39) I753L probably benign Het
Rad21 T C 15: 51,841,566 (GRCm39) K50R probably damaging Het
Rad54b A G 4: 11,604,989 (GRCm39) E479G possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rgs20 C T 1: 4,980,863 (GRCm39) R154Q probably damaging Het
Sbf1 T C 15: 89,178,628 (GRCm39) D1449G probably damaging Het
Sema4g C T 19: 44,990,044 (GRCm39) R708* probably null Het
Septin9 T C 11: 117,181,254 (GRCm39) I18T probably benign Het
Serpinb6b A G 13: 33,162,041 (GRCm39) E280G probably damaging Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc6a21 G A 7: 44,937,158 (GRCm39) W554* probably null Het
Slco1a4 A C 6: 141,758,457 (GRCm39) I518R probably benign Het
Stab1 T A 14: 30,890,373 (GRCm39) Q26L probably benign Het
Stox1 A G 10: 62,503,744 (GRCm39) F104L probably damaging Het
Suco T C 1: 161,662,518 (GRCm39) K638E possibly damaging Het
Synpo T C 18: 60,735,856 (GRCm39) K458E probably damaging Het
Szt2 A T 4: 118,229,565 (GRCm39) W2820R unknown Het
Tmtc1 C A 6: 148,196,116 (GRCm39) G499W probably damaging Het
Tonsl A C 15: 76,522,266 (GRCm39) S242R probably damaging Het
Trpc4 G T 3: 54,102,243 (GRCm39) S47I possibly damaging Het
Zfp106 G A 2: 120,350,909 (GRCm39) R1581C probably benign Het
Zfp27 A G 7: 29,594,801 (GRCm39) L388P possibly damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109,421,439 (GRCm39) missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109,420,985 (GRCm39) unclassified probably benign
R1250:Dlk1 UTSW 12 109,425,744 (GRCm39) missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109,421,430 (GRCm39) missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109,425,613 (GRCm39) missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109,425,685 (GRCm39) missense probably damaging 1.00
R2189:Dlk1 UTSW 12 109,420,975 (GRCm39) critical splice donor site probably null
R2334:Dlk1 UTSW 12 109,419,614 (GRCm39) missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109,426,239 (GRCm39) missense probably benign 0.15
R5256:Dlk1 UTSW 12 109,425,697 (GRCm39) missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109,425,764 (GRCm39) missense probably benign 0.34
R5356:Dlk1 UTSW 12 109,421,447 (GRCm39) missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109,425,964 (GRCm39) missense probably benign 0.04
R5748:Dlk1 UTSW 12 109,425,898 (GRCm39) missense probably benign 0.00
R5992:Dlk1 UTSW 12 109,421,507 (GRCm39) missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109,425,895 (GRCm39) missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109,426,245 (GRCm39) missense probably benign 0.01
R6638:Dlk1 UTSW 12 109,426,204 (GRCm39) missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109,421,540 (GRCm39) missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109,420,889 (GRCm39) missense unknown
R7602:Dlk1 UTSW 12 109,421,551 (GRCm39) critical splice donor site probably null
R8531:Dlk1 UTSW 12 109,424,066 (GRCm39) missense probably null 0.06
R9120:Dlk1 UTSW 12 109,424,051 (GRCm39) missense probably benign 0.00
R9554:Dlk1 UTSW 12 109,420,889 (GRCm39) missense unknown
X0020:Dlk1 UTSW 12 109,425,838 (GRCm39) missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109,426,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGAAATCACTAGCTGAGCCAC -3'
(R):5'- TGTCATTCACCAGCATTGGAGCC -3'

Sequencing Primer
(F):5'- ACTAGCTGAGCCACTTAGGG -3'
(R):5'- GGGGAGCACATCTTTCATCAG -3'
Posted On 2014-05-23