Incidental Mutation 'R1763:Iars'
ID 193222
Institutional Source Beutler Lab
Gene Symbol Iars
Ensembl Gene ENSMUSG00000037851
Gene Name isoleucine-tRNA synthetase
Synonyms E430001P04Rik, 2510016L12Rik
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 49682100-49734267 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 49723077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]
AlphaFold Q8BU30
Predicted Effect probably null
Transcript: ENSMUST00000047363
SMART Domains Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 9.2e-242 PFAM
Pfam:tRNA-synt_1g 46 197 3.7e-6 PFAM
Pfam:Anticodon_1 693 852 1.1e-23 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164260
SMART Domains Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165270
Predicted Effect probably null
Transcript: ENSMUST00000165316
SMART Domains Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165656
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Iars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Iars APN 13 49709728 missense probably damaging 1.00
IGL00764:Iars APN 13 49711827 missense probably benign 0.34
IGL01153:Iars APN 13 49711805 missense probably damaging 1.00
IGL01481:Iars APN 13 49728698 missense probably benign 0.00
IGL01596:Iars APN 13 49703176 missense probably benign
IGL01682:Iars APN 13 49709658 missense probably damaging 1.00
IGL01885:Iars APN 13 49691499 missense probably benign 0.25
IGL01907:Iars APN 13 49709655 missense probably damaging 1.00
IGL02023:Iars APN 13 49688249 missense probably damaging 1.00
IGL02121:Iars APN 13 49724696 missense probably benign 0.00
IGL02365:Iars APN 13 49691499 missense probably benign 0.25
IGL02704:Iars APN 13 49721100 missense probably damaging 1.00
IGL02838:Iars APN 13 49690489 missense possibly damaging 0.87
IGL02975:Iars APN 13 49704849 missense probably damaging 1.00
IGL02982:Iars APN 13 49709709 missense probably benign 0.00
IGL03034:Iars APN 13 49690489 missense possibly damaging 0.87
IGL03060:Iars APN 13 49690447 critical splice acceptor site probably null
IGL03156:Iars APN 13 49703179 missense possibly damaging 0.87
IGL03206:Iars APN 13 49693070 missense possibly damaging 0.81
IGL03343:Iars APN 13 49724747 missense probably benign 0.12
gannett_peak UTSW 13 49708421 missense probably damaging 1.00
missouri UTSW 13 49688276 missense possibly damaging 0.82
spacex UTSW 13 49723002 missense possibly damaging 0.85
wind_river UTSW 13 49701895 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0184:Iars UTSW 13 49722212 missense probably benign 0.00
R0200:Iars UTSW 13 49726202 missense possibly damaging 0.62
R0356:Iars UTSW 13 49703233 missense probably benign 0.03
R0383:Iars UTSW 13 49732342 missense probably damaging 0.99
R0657:Iars UTSW 13 49702519 missense probably damaging 1.00
R1005:Iars UTSW 13 49687445 missense possibly damaging 0.94
R1427:Iars UTSW 13 49704269 critical splice acceptor site probably null
R1449:Iars UTSW 13 49733710 missense probably damaging 0.99
R1647:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1648:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1664:Iars UTSW 13 49711775 missense probably damaging 0.98
R2192:Iars UTSW 13 49688129 splice site probably null
R2203:Iars UTSW 13 49722675 missense probably benign 0.00
R2357:Iars UTSW 13 49688203 missense probably damaging 1.00
R3724:Iars UTSW 13 49687384 critical splice acceptor site probably null
R4785:Iars UTSW 13 49724663 missense probably damaging 0.99
R4934:Iars UTSW 13 49717984 missense probably benign 0.17
R4999:Iars UTSW 13 49709661 missense probably damaging 1.00
R5048:Iars UTSW 13 49688237 missense probably damaging 0.99
R5268:Iars UTSW 13 49690491 missense probably damaging 1.00
R5394:Iars UTSW 13 49722165 missense probably damaging 1.00
R5486:Iars UTSW 13 49709573 splice site probably null
R5960:Iars UTSW 13 49724637 missense possibly damaging 0.68
R5972:Iars UTSW 13 49709632 missense possibly damaging 0.91
R5978:Iars UTSW 13 49722993 missense probably damaging 0.99
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6092:Iars UTSW 13 49708421 missense probably damaging 1.00
R6167:Iars UTSW 13 49722714 missense probably damaging 1.00
R6313:Iars UTSW 13 49708445 missense probably damaging 0.99
R6358:Iars UTSW 13 49727143 missense possibly damaging 0.67
R6385:Iars UTSW 13 49701895 missense probably damaging 1.00
R6403:Iars UTSW 13 49687495 missense probably damaging 1.00
R6575:Iars UTSW 13 49725269 missense probably damaging 1.00
R6675:Iars UTSW 13 49719578 missense probably damaging 0.99
R6957:Iars UTSW 13 49722161 missense probably damaging 1.00
R7207:Iars UTSW 13 49688315 critical splice donor site probably null
R7254:Iars UTSW 13 49723078 critical splice donor site probably null
R7354:Iars UTSW 13 49704320 missense probably benign
R7397:Iars UTSW 13 49728677 missense probably benign 0.00
R7696:Iars UTSW 13 49706738 missense probably damaging 1.00
R7799:Iars UTSW 13 49723018 missense probably damaging 1.00
R7828:Iars UTSW 13 49725272 missense probably benign
R8679:Iars UTSW 13 49703199 unclassified probably benign
R8768:Iars UTSW 13 49724626 missense probably damaging 0.99
R8797:Iars UTSW 13 49688262 missense probably benign 0.12
R8906:Iars UTSW 13 49728701 missense probably benign
R8990:Iars UTSW 13 49688276 missense possibly damaging 0.82
R9134:Iars UTSW 13 49701847 missense probably benign 0.00
R9137:Iars UTSW 13 49701874 missense probably benign
R9394:Iars UTSW 13 49730060 missense probably benign
Z1088:Iars UTSW 13 49721088 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTAGACTTTGCAGCAGTGGTG -3'
(R):5'- GGGAACCTTTCTCAGAGGGCAAATG -3'

Sequencing Primer
(F):5'- ACTTTGCAGCAGTGGTGTAATTC -3'
(R):5'- ccttgaactcagaaatctgcc -3'
Posted On 2014-05-23