Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Rad21'

193227

Institutional Source

Beutler Lab

Gene Symbol

Rad21

Ensembl Gene

ENSMUSG00000022314

Gene Name

RAD21 cohesin complex component

Synonyms

SCC1

MMRRC Submission

039795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51962240-51991747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51978170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 50 (K50R)

Ref Sequence

ENSEMBL: ENSMUSP00000022927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022927] [ENSMUST00000226529]

AlphaFold

Q61550

Predicted Effect

probably damaging
Transcript: ENSMUST00000022927
AA Change: K50R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: K50R

Domain	Start	End	E-Value	Type
Pfam:Rad21_Rec8_N	1	107	6.6e-43	PFAM
low complexity region	267	283	N/A	INTRINSIC
low complexity region	430	440	N/A	INTRINSIC
low complexity region	502	514	N/A	INTRINSIC
low complexity region	521	547	N/A	INTRINSIC
Pfam:Rad21_Rec8	578	632	2.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226529
AA Change: K50R

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.5361

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Rad21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Rad21	APN	15	51976125	missense	possibly damaging	0.76
IGL01328:Rad21	APN	15	51973124	missense	probably damaging	1.00
PIT4449001:Rad21	UTSW	15	51973243	missense	probably benign	0.25
R0119:Rad21	UTSW	15	51965030	missense	probably benign	0.01
R0299:Rad21	UTSW	15	51965030	missense	probably benign	0.01
R0385:Rad21	UTSW	15	51973863	missense	possibly damaging	0.70
R0440:Rad21	UTSW	15	51968358	missense	probably benign	0.24
R1216:Rad21	UTSW	15	51970136	missense	possibly damaging	0.70
R1631:Rad21	UTSW	15	51970040	missense	probably damaging	1.00
R1769:Rad21	UTSW	15	51972307	missense	probably benign
R2377:Rad21	UTSW	15	51968438	missense	probably damaging	0.99
R2761:Rad21	UTSW	15	51982643	missense	probably damaging	1.00
R3116:Rad21	UTSW	15	51965001	missense	probably null	1.00
R3853:Rad21	UTSW	15	51972316	missense	probably benign
R3875:Rad21	UTSW	15	51969965	missense	probably damaging	0.99
R4618:Rad21	UTSW	15	51970024	missense	probably damaging	1.00
R4856:Rad21	UTSW	15	51968500	missense	probably damaging	1.00
R4886:Rad21	UTSW	15	51968500	missense	probably damaging	1.00
R5022:Rad21	UTSW	15	51966706	missense	probably benign	0.02
R5057:Rad21	UTSW	15	51966706	missense	probably benign	0.02
R7288:Rad21	UTSW	15	51982580	missense	possibly damaging	0.94
R7840:Rad21	UTSW	15	51973142	missense	probably damaging	1.00
R7980:Rad21	UTSW	15	51965026	missense	probably benign	0.07
R8033:Rad21	UTSW	15	51964232	missense	probably damaging	1.00
R8770:Rad21	UTSW	15	51968353	missense	probably benign	0.00
R9176:Rad21	UTSW	15	51978059	missense	probably damaging	0.99
Z1088:Rad21	UTSW	15	51982626	missense	probably damaging	0.97
Z1177:Rad21	UTSW	15	51978058	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCAAGCTGCTGAGACTAGGTAAAC -3'
(R):5'- TGGTGTGCTGATGGCAACATCC -3'

Sequencing Primer
(F):5'- TGGACAGTGCTCCCTACAATG -3'
(R):5'- AAGATCGGCTTTCTGCTTCATAG -3'

Posted On

2014-05-23