Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Col22a1'

193229

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

039795-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72007176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 44 (V44A)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

AlphaFold

E9Q7P1

Predicted Effect

probably damaging
Transcript: ENSMUST00000159993
AA Change: V44A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: V44A

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.1625

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9406:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R9577:Col22a1	UTSW	15	71965746	missense	probably damaging	0.99
R9727:Col22a1	UTSW	15	71977274	missense	probably damaging	1.00
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCTGCTTGAAGGCACGATTCC -3'
(R):5'- TGAGACTCTGTAACCACCCTGCTG -3'

Sequencing Primer
(F):5'- TATAACGCAGGGCGTCAC -3'
(R):5'- CCCTGCTGTGGGATGTCAG -3'

Posted On

2014-05-23