Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Gabbr1'

193236

Institutional Source

Beutler Lab

Gene Symbol

Gabbr1

Ensembl Gene

ENSMUSG00000024462

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 1

Synonyms

GABAB1, GABAbR1

MMRRC Submission

039795-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.615) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37045966-37075067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 37054767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 158 (S158A)

Ref Sequence

ENSEMBL: ENSMUSP00000134268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347]

AlphaFold

Q9WV18

Predicted Effect

probably damaging
Transcript: ENSMUST00000025338
AA Change: S274A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: S274A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CCP	29	95	8.72e0	SMART
CCP	99	156	3.03e-10	SMART
Pfam:Peripla_BP_6	168	538	1.6e-23	PFAM
Pfam:ANF_receptor	186	542	4.3e-73	PFAM
Pfam:7tm_3	602	858	9.8e-49	PFAM
coiled coil region	877	922	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172792
AA Change: S158A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: S158A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:Peripla_BP_6	52	428	7.8e-24	PFAM
Pfam:ANF_receptor	70	426	5.7e-68	PFAM
Pfam:7tm_3	484	743	1.1e-50	PFAM
coiled coil region	761	806	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173564

Predicted Effect

probably benign
Transcript: ENSMUST00000173823

SMART Domains

Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sushi	29	95	1.6e-6	PFAM
low complexity region	159	176	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174347
AA Change: S113A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462
AA Change: S113A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:ANF_receptor	102	213	1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174866

Meta Mutation Damage Score

0.4625

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Gabbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Gabbr1	APN	17	37048443	nonsense	probably null
IGL01309:Gabbr1	APN	17	37048607	critical splice donor site	probably null
IGL01413:Gabbr1	APN	17	37062706	missense	possibly damaging	0.93
IGL01568:Gabbr1	APN	17	37070669	missense	probably damaging	1.00
IGL01845:Gabbr1	APN	17	37048414	splice site	probably benign
IGL02083:Gabbr1	APN	17	37070065	missense	possibly damaging	0.84
IGL02302:Gabbr1	APN	17	37054797	missense	probably damaging	1.00
IGL02430:Gabbr1	APN	17	37056308	nonsense	probably null
IGL02533:Gabbr1	APN	17	37072147	missense	probably damaging	1.00
IGL02810:Gabbr1	APN	17	37062762	missense	probably damaging	1.00
H8562:Gabbr1	UTSW	17	37071949	missense	probably damaging	1.00
PIT4449001:Gabbr1	UTSW	17	37056350	missense	probably damaging	1.00
R0025:Gabbr1	UTSW	17	37067210	intron	probably benign
R0420:Gabbr1	UTSW	17	37046762	missense	possibly damaging	0.68
R0464:Gabbr1	UTSW	17	37050834	unclassified	probably benign
R1306:Gabbr1	UTSW	17	37055990	splice site	probably null
R1412:Gabbr1	UTSW	17	37054913	splice site	probably null
R1495:Gabbr1	UTSW	17	37055940	missense	possibly damaging	0.68
R1612:Gabbr1	UTSW	17	37070669	missense	probably damaging	1.00
R1658:Gabbr1	UTSW	17	37047507	missense	probably damaging	0.96
R1779:Gabbr1	UTSW	17	37054879	missense	probably damaging	1.00
R1964:Gabbr1	UTSW	17	37048459	missense	probably damaging	1.00
R1996:Gabbr1	UTSW	17	37069220	missense	probably damaging	1.00
R2014:Gabbr1	UTSW	17	37056782	splice site	probably null
R2255:Gabbr1	UTSW	17	37071866	missense	probably damaging	1.00
R4299:Gabbr1	UTSW	17	37055900	nonsense	probably null
R4458:Gabbr1	UTSW	17	37067775	critical splice acceptor site	probably null
R4510:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4511:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4571:Gabbr1	UTSW	17	37054236	nonsense	probably null
R4597:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.74
R5109:Gabbr1	UTSW	17	37072028	intron	probably benign
R5119:Gabbr1	UTSW	17	37048438	missense	probably damaging	0.99
R5227:Gabbr1	UTSW	17	37070066	missense	possibly damaging	0.93
R5253:Gabbr1	UTSW	17	37055913	missense	possibly damaging	0.87
R5443:Gabbr1	UTSW	17	37070756	missense	probably damaging	1.00
R5485:Gabbr1	UTSW	17	37056875	missense	possibly damaging	0.83
R5839:Gabbr1	UTSW	17	37067868	missense	probably damaging	1.00
R5976:Gabbr1	UTSW	17	37067862	missense	probably damaging	1.00
R6156:Gabbr1	UTSW	17	37048427	missense	probably benign	0.01
R6167:Gabbr1	UTSW	17	37063379	missense	probably damaging	1.00
R6214:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6215:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6348:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.94
R6721:Gabbr1	UTSW	17	37054192	missense	probably damaging	0.98
R7028:Gabbr1	UTSW	17	37064737	nonsense	probably null
R7317:Gabbr1	UTSW	17	37069413	missense	probably damaging	1.00
R7786:Gabbr1	UTSW	17	37070063	missense	probably damaging	0.98
R7793:Gabbr1	UTSW	17	37047501	missense	probably benign	0.13
R7833:Gabbr1	UTSW	17	37056969	missense	possibly damaging	0.88
R8110:Gabbr1	UTSW	17	37048583	missense	probably benign	0.10
R8318:Gabbr1	UTSW	17	37062543	missense	probably benign	0.23
R8774:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8774-TAIL:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8890:Gabbr1	UTSW	17	37047544	missense	probably benign	0.02
R9144:Gabbr1	UTSW	17	37051157	missense	probably benign
R9292:Gabbr1	UTSW	17	37055892	missense	possibly damaging	0.94
R9359:Gabbr1	UTSW	17	37070713	missense	probably damaging	1.00
X0010:Gabbr1	UTSW	17	37070780	missense	probably damaging	0.99
Z1177:Gabbr1	UTSW	17	37048424	missense	possibly damaging	0.57

Predicted Primers

PCR Primer
(F):5'- CTGGGTTGAGTAGAAAGCTCATGGC -3'
(R):5'- ATCCAATTCGTGTGTTCCCCAGG -3'

Sequencing Primer
(F):5'- acttagaaatccgcctgcc -3'
(R):5'- GTGTTCCCCAGGCTACAGAAAG -3'

Posted On

2014-05-23