Incidental Mutation 'R1764:Gon4l'
ID 193255
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Name gon-4 like
Synonyms 1500041I23Rik, 2610100B20Rik
MMRRC Submission 039796-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.903) question?
Stock # R1764 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88742531-88817406 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 88799906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 850 (K850N)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: K850N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: K850N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: K851N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: K851N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: K850N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: K850N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect probably benign
Transcript: ENSMUST00000212694
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,884,655 (GRCm39) V401A probably benign Het
Abca7 G T 10: 79,844,784 (GRCm39) W1502L probably damaging Het
Adcy7 A G 8: 89,035,468 (GRCm39) E124G probably benign Het
Aif1l G A 2: 31,855,118 (GRCm39) E66K probably benign Het
Aldh8a1 A T 10: 21,271,392 (GRCm39) M373L probably benign Het
Alg6 T C 4: 99,629,815 (GRCm39) Y131H probably benign Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Arrdc4 A T 7: 68,391,622 (GRCm39) I215K probably damaging Het
Asb4 A G 6: 5,390,798 (GRCm39) probably null Het
Astn1 T C 1: 158,331,821 (GRCm39) I305T probably benign Het
Atp5f1b T A 10: 127,919,949 (GRCm39) probably benign Het
Atp8a1 C A 5: 67,788,910 (GRCm39) M1044I probably benign Het
Atp9b C T 18: 80,952,806 (GRCm39) probably null Het
Brd10 T A 19: 29,696,560 (GRCm39) T978S possibly damaging Het
Btaf1 A G 19: 36,928,518 (GRCm39) H113R probably benign Het
C87436 G T 6: 86,430,594 (GRCm39) C338F possibly damaging Het
Casz1 T C 4: 149,027,357 (GRCm39) probably benign Het
Cbr3 T A 16: 93,487,370 (GRCm39) H184Q probably damaging Het
Cct8l1 T C 5: 25,722,097 (GRCm39) S271P possibly damaging Het
Cdc34 A G 10: 79,521,174 (GRCm39) K77R probably benign Het
Cdc34 G T 10: 79,521,172 (GRCm39) probably null Het
Cdh20 A G 1: 104,862,070 (GRCm39) probably benign Het
Celsr3 A G 9: 108,706,157 (GRCm39) E880G probably damaging Het
Cers1 T G 8: 70,774,141 (GRCm39) probably null Het
Cntn5 T C 9: 9,673,988 (GRCm39) I705V probably benign Het
Dennd4c T A 4: 86,721,247 (GRCm39) D636E probably damaging Het
Dnah11 T C 12: 118,154,560 (GRCm39) E240G probably benign Het
Dnah2 T C 11: 69,314,369 (GRCm39) Y4100C probably damaging Het
Dpysl3 T C 18: 43,496,583 (GRCm39) E151G probably damaging Het
Efcab9 T G 11: 32,474,457 (GRCm39) T9P possibly damaging Het
Eif4g2 A T 7: 110,673,694 (GRCm39) F725Y probably damaging Het
Epha6 T A 16: 59,596,091 (GRCm39) I867F probably null Het
Erbin T C 13: 103,979,959 (GRCm39) probably benign Het
Evi5l A G 8: 4,253,560 (GRCm39) E468G probably damaging Het
Filip1l C T 16: 57,390,401 (GRCm39) R330W probably damaging Het
Fmo3 C T 1: 162,786,142 (GRCm39) V283M possibly damaging Het
Gabarapl1 A T 6: 129,510,481 (GRCm39) K24N possibly damaging Het
Gigyf1 C T 5: 137,520,770 (GRCm39) probably benign Het
Gm5581 T A 6: 131,158,362 (GRCm39) noncoding transcript Het
Igf2bp3 C T 6: 49,085,980 (GRCm39) R233H probably damaging Het
Iqcf4 G A 9: 106,445,893 (GRCm39) R85C probably benign Het
Kalrn C T 16: 34,033,243 (GRCm39) R473Q probably damaging Het
Lmod2 T A 6: 24,603,376 (GRCm39) V117E probably damaging Het
Mapk11 A G 15: 89,028,594 (GRCm39) probably null Het
Mcm3 G A 1: 20,876,103 (GRCm39) R664C probably damaging Het
Mex3d A G 10: 80,222,770 (GRCm39) M162T probably benign Het
Mrgprb3 A G 7: 48,292,771 (GRCm39) I260T probably benign Het
Ncor2 G T 5: 125,105,679 (GRCm39) A1637D possibly damaging Het
Nedd4 T A 9: 72,638,189 (GRCm39) D441E probably damaging Het
Nek5 A T 8: 22,599,928 (GRCm39) C194S probably damaging Het
Nos1ap T C 1: 170,146,447 (GRCm39) D369G possibly damaging Het
Ntrk1 G T 3: 87,687,391 (GRCm39) T681K probably damaging Het
Or13a24 T C 7: 140,154,383 (GRCm39) W106R probably damaging Het
Or4f14 A G 2: 111,742,526 (GRCm39) F250L possibly damaging Het
Otogl C T 10: 107,735,322 (GRCm39) W154* probably null Het
Pcdh20 T C 14: 88,706,620 (GRCm39) T227A possibly damaging Het
Pcdhb17 T C 18: 37,620,324 (GRCm39) S705P probably damaging Het
Piezo2 T C 18: 63,257,713 (GRCm39) H335R possibly damaging Het
Pkn2 T C 3: 142,499,615 (GRCm39) Q954R probably damaging Het
Pramel23 C A 4: 143,424,840 (GRCm39) C201F probably benign Het
Prkcq G A 2: 11,237,442 (GRCm39) V74M probably damaging Het
Prkrip1 A T 5: 136,218,489 (GRCm39) probably null Het
Pttg1ip2 A T 5: 5,528,943 (GRCm39) I24N possibly damaging Het
Rb1cc1 A G 1: 6,284,904 (GRCm39) probably benign Het
Rbm5 A T 9: 107,644,763 (GRCm39) Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr3 C A 2: 112,690,805 (GRCm39) V1082L probably damaging Het
Scart2 A G 7: 139,877,178 (GRCm39) E831G probably benign Het
Sel1l3 C A 5: 53,327,789 (GRCm39) E497* probably null Het
Serpina6 A T 12: 103,620,182 (GRCm39) I189N probably damaging Het
Serpinb11 A T 1: 107,304,532 (GRCm39) T166S probably benign Het
Skint7 T C 4: 111,839,270 (GRCm39) L188S probably benign Het
Slc25a45 C T 19: 5,934,958 (GRCm39) A269V probably damaging Het
Sltm A G 9: 70,469,082 (GRCm39) T114A probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Spen C A 4: 141,200,261 (GRCm39) V2766L probably damaging Het
Srgap2 T A 1: 131,247,275 (GRCm39) I445F possibly damaging Het
Stox2 A T 8: 47,647,051 (GRCm39) Y200* probably null Het
Strada C A 11: 106,055,010 (GRCm39) R384L probably damaging Het
Tctn2 G A 5: 124,757,094 (GRCm39) noncoding transcript Het
Tgfbr3l G T 8: 4,299,282 (GRCm39) R461L probably benign Het
Tmem65 A G 15: 58,661,998 (GRCm39) probably benign Het
Tpst1 G T 5: 130,143,343 (GRCm39) V294F possibly damaging Het
Trim23 A G 13: 104,335,126 (GRCm39) Y384C probably damaging Het
Ube3b C G 5: 114,542,678 (GRCm39) L512V possibly damaging Het
Ubxn4 T A 1: 128,183,916 (GRCm39) V92E probably damaging Het
Vmn2r57 A T 7: 41,050,067 (GRCm39) C561S probably damaging Het
Vwa8 A G 14: 79,145,635 (GRCm39) D104G probably damaging Het
Wdr25 T A 12: 108,992,364 (GRCm39) L73* probably null Het
Wnt9a G A 11: 59,221,728 (GRCm39) A209T probably benign Het
Zcchc17 A C 4: 130,223,388 (GRCm39) C133G probably damaging Het
Zdhhc18 T A 4: 133,335,987 (GRCm39) M375L probably benign Het
Zfhx3 T C 8: 109,678,276 (GRCm39) F3109L probably benign Het
Zfp202 T A 9: 40,121,762 (GRCm39) D286E probably benign Het
Zzef1 T C 11: 72,784,158 (GRCm39) L2021P probably benign Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88,764,492 (GRCm39) missense probably damaging 1.00
IGL02002:Gon4l APN 3 88,802,643 (GRCm39) missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88,764,517 (GRCm39) missense probably null 1.00
IGL02283:Gon4l APN 3 88,802,671 (GRCm39) missense probably damaging 0.99
IGL02669:Gon4l APN 3 88,802,806 (GRCm39) missense probably damaging 1.00
IGL03222:Gon4l APN 3 88,802,950 (GRCm39) missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88,814,850 (GRCm39) missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88,802,821 (GRCm39) missense probably damaging 1.00
R0020:Gon4l UTSW 3 88,766,244 (GRCm39) missense probably damaging 1.00
R0115:Gon4l UTSW 3 88,802,989 (GRCm39) missense probably damaging 1.00
R0173:Gon4l UTSW 3 88,765,710 (GRCm39) missense probably damaging 1.00
R0270:Gon4l UTSW 3 88,765,707 (GRCm39) missense probably damaging 1.00
R0961:Gon4l UTSW 3 88,805,403 (GRCm39) splice site probably benign
R1017:Gon4l UTSW 3 88,765,803 (GRCm39) missense probably benign 0.15
R1163:Gon4l UTSW 3 88,799,842 (GRCm39) missense probably damaging 1.00
R1729:Gon4l UTSW 3 88,810,405 (GRCm39) missense probably damaging 1.00
R1861:Gon4l UTSW 3 88,802,794 (GRCm39) missense probably damaging 1.00
R2141:Gon4l UTSW 3 88,794,902 (GRCm39) missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88,770,824 (GRCm39) missense probably damaging 1.00
R2402:Gon4l UTSW 3 88,766,350 (GRCm39) missense probably damaging 1.00
R2842:Gon4l UTSW 3 88,802,794 (GRCm39) missense probably damaging 1.00
R4375:Gon4l UTSW 3 88,814,694 (GRCm39) missense probably benign 0.00
R4376:Gon4l UTSW 3 88,814,694 (GRCm39) missense probably benign 0.00
R4377:Gon4l UTSW 3 88,814,694 (GRCm39) missense probably benign 0.00
R4569:Gon4l UTSW 3 88,817,397 (GRCm39) intron probably benign
R4650:Gon4l UTSW 3 88,770,859 (GRCm39) missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88,802,655 (GRCm39) missense probably benign 0.00
R4901:Gon4l UTSW 3 88,815,458 (GRCm39) missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88,807,305 (GRCm39) missense probably damaging 1.00
R5059:Gon4l UTSW 3 88,807,319 (GRCm39) missense probably benign 0.00
R5217:Gon4l UTSW 3 88,794,882 (GRCm39) missense probably damaging 1.00
R5269:Gon4l UTSW 3 88,802,835 (GRCm39) missense probably benign
R5279:Gon4l UTSW 3 88,794,944 (GRCm39) missense probably benign
R5283:Gon4l UTSW 3 88,794,897 (GRCm39) missense probably damaging 1.00
R5386:Gon4l UTSW 3 88,765,803 (GRCm39) missense probably benign 0.15
R5433:Gon4l UTSW 3 88,803,532 (GRCm39) missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88,807,278 (GRCm39) missense probably damaging 1.00
R5695:Gon4l UTSW 3 88,803,523 (GRCm39) frame shift probably null
R5921:Gon4l UTSW 3 88,817,254 (GRCm39) intron probably benign
R6003:Gon4l UTSW 3 88,803,400 (GRCm39) missense probably damaging 0.99
R6063:Gon4l UTSW 3 88,807,306 (GRCm39) missense probably damaging 1.00
R6217:Gon4l UTSW 3 88,799,968 (GRCm39) missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88,763,156 (GRCm39) missense probably damaging 1.00
R6280:Gon4l UTSW 3 88,798,195 (GRCm39) missense probably damaging 1.00
R6790:Gon4l UTSW 3 88,766,305 (GRCm39) missense probably damaging 1.00
R6829:Gon4l UTSW 3 88,787,413 (GRCm39) missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88,766,173 (GRCm39) splice site probably null
R7128:Gon4l UTSW 3 88,802,999 (GRCm39) missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88,802,486 (GRCm39) missense probably benign 0.00
R7355:Gon4l UTSW 3 88,770,827 (GRCm39) missense probably damaging 1.00
R7426:Gon4l UTSW 3 88,814,829 (GRCm39) missense probably benign
R7635:Gon4l UTSW 3 88,802,413 (GRCm39) missense probably benign 0.03
R7643:Gon4l UTSW 3 88,810,114 (GRCm39) missense probably damaging 1.00
R7715:Gon4l UTSW 3 88,815,313 (GRCm39) missense probably benign
R7773:Gon4l UTSW 3 88,803,102 (GRCm39) missense probably benign 0.00
R8090:Gon4l UTSW 3 88,799,931 (GRCm39) missense probably damaging 1.00
R8224:Gon4l UTSW 3 88,802,449 (GRCm39) missense probably damaging 1.00
R8260:Gon4l UTSW 3 88,799,937 (GRCm39) missense probably damaging 0.98
R8434:Gon4l UTSW 3 88,762,086 (GRCm39) missense probably damaging 1.00
R8732:Gon4l UTSW 3 88,807,291 (GRCm39) missense possibly damaging 0.95
R8812:Gon4l UTSW 3 88,802,314 (GRCm39) missense possibly damaging 0.86
R9132:Gon4l UTSW 3 88,815,484 (GRCm39) missense probably benign 0.29
R9161:Gon4l UTSW 3 88,808,955 (GRCm39) missense probably damaging 1.00
R9187:Gon4l UTSW 3 88,786,618 (GRCm39) missense probably benign 0.10
R9212:Gon4l UTSW 3 88,803,730 (GRCm39) missense probably benign 0.01
R9338:Gon4l UTSW 3 88,809,019 (GRCm39) missense probably benign 0.00
R9387:Gon4l UTSW 3 88,802,260 (GRCm39) missense probably benign 0.00
R9416:Gon4l UTSW 3 88,803,538 (GRCm39) missense probably benign 0.00
R9607:Gon4l UTSW 3 88,765,751 (GRCm39) missense probably damaging 0.99
Z1177:Gon4l UTSW 3 88,766,343 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCGGTGTTCAGAGTATGCAG -3'
(R):5'- GACAGGGTTCAGTGAGACATCAGTG -3'

Sequencing Primer
(F):5'- CGCAGTGATCTGTAACTCTCTAAGG -3'
(R):5'- GTTCAGTGAGACATCAGTGTCTAAC -3'
Posted On 2014-05-23