Incidental Mutation 'R1764:Ube3b'
ID 193273
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 039796-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1764 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 114542678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 512 (L512V)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: L512V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: L512V

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183408
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,884,655 (GRCm39) V401A probably benign Het
Abca7 G T 10: 79,844,784 (GRCm39) W1502L probably damaging Het
Adcy7 A G 8: 89,035,468 (GRCm39) E124G probably benign Het
Aif1l G A 2: 31,855,118 (GRCm39) E66K probably benign Het
Aldh8a1 A T 10: 21,271,392 (GRCm39) M373L probably benign Het
Alg6 T C 4: 99,629,815 (GRCm39) Y131H probably benign Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Arrdc4 A T 7: 68,391,622 (GRCm39) I215K probably damaging Het
Asb4 A G 6: 5,390,798 (GRCm39) probably null Het
Astn1 T C 1: 158,331,821 (GRCm39) I305T probably benign Het
Atp5f1b T A 10: 127,919,949 (GRCm39) probably benign Het
Atp8a1 C A 5: 67,788,910 (GRCm39) M1044I probably benign Het
Atp9b C T 18: 80,952,806 (GRCm39) probably null Het
Brd10 T A 19: 29,696,560 (GRCm39) T978S possibly damaging Het
Btaf1 A G 19: 36,928,518 (GRCm39) H113R probably benign Het
C87436 G T 6: 86,430,594 (GRCm39) C338F possibly damaging Het
Casz1 T C 4: 149,027,357 (GRCm39) probably benign Het
Cbr3 T A 16: 93,487,370 (GRCm39) H184Q probably damaging Het
Cct8l1 T C 5: 25,722,097 (GRCm39) S271P possibly damaging Het
Cdc34 A G 10: 79,521,174 (GRCm39) K77R probably benign Het
Cdc34 G T 10: 79,521,172 (GRCm39) probably null Het
Cdh20 A G 1: 104,862,070 (GRCm39) probably benign Het
Celsr3 A G 9: 108,706,157 (GRCm39) E880G probably damaging Het
Cers1 T G 8: 70,774,141 (GRCm39) probably null Het
Cntn5 T C 9: 9,673,988 (GRCm39) I705V probably benign Het
Dennd4c T A 4: 86,721,247 (GRCm39) D636E probably damaging Het
Dnah11 T C 12: 118,154,560 (GRCm39) E240G probably benign Het
Dnah2 T C 11: 69,314,369 (GRCm39) Y4100C probably damaging Het
Dpysl3 T C 18: 43,496,583 (GRCm39) E151G probably damaging Het
Efcab9 T G 11: 32,474,457 (GRCm39) T9P possibly damaging Het
Eif4g2 A T 7: 110,673,694 (GRCm39) F725Y probably damaging Het
Epha6 T A 16: 59,596,091 (GRCm39) I867F probably null Het
Erbin T C 13: 103,979,959 (GRCm39) probably benign Het
Evi5l A G 8: 4,253,560 (GRCm39) E468G probably damaging Het
Filip1l C T 16: 57,390,401 (GRCm39) R330W probably damaging Het
Fmo3 C T 1: 162,786,142 (GRCm39) V283M possibly damaging Het
Gabarapl1 A T 6: 129,510,481 (GRCm39) K24N possibly damaging Het
Gigyf1 C T 5: 137,520,770 (GRCm39) probably benign Het
Gm5581 T A 6: 131,158,362 (GRCm39) noncoding transcript Het
Gon4l G T 3: 88,799,906 (GRCm39) K850N probably damaging Het
Igf2bp3 C T 6: 49,085,980 (GRCm39) R233H probably damaging Het
Iqcf4 G A 9: 106,445,893 (GRCm39) R85C probably benign Het
Kalrn C T 16: 34,033,243 (GRCm39) R473Q probably damaging Het
Lmod2 T A 6: 24,603,376 (GRCm39) V117E probably damaging Het
Mapk11 A G 15: 89,028,594 (GRCm39) probably null Het
Mcm3 G A 1: 20,876,103 (GRCm39) R664C probably damaging Het
Mex3d A G 10: 80,222,770 (GRCm39) M162T probably benign Het
Mrgprb3 A G 7: 48,292,771 (GRCm39) I260T probably benign Het
Ncor2 G T 5: 125,105,679 (GRCm39) A1637D possibly damaging Het
Nedd4 T A 9: 72,638,189 (GRCm39) D441E probably damaging Het
Nek5 A T 8: 22,599,928 (GRCm39) C194S probably damaging Het
Nos1ap T C 1: 170,146,447 (GRCm39) D369G possibly damaging Het
Ntrk1 G T 3: 87,687,391 (GRCm39) T681K probably damaging Het
Or13a24 T C 7: 140,154,383 (GRCm39) W106R probably damaging Het
Or4f14 A G 2: 111,742,526 (GRCm39) F250L possibly damaging Het
Otogl C T 10: 107,735,322 (GRCm39) W154* probably null Het
Pcdh20 T C 14: 88,706,620 (GRCm39) T227A possibly damaging Het
Pcdhb17 T C 18: 37,620,324 (GRCm39) S705P probably damaging Het
Piezo2 T C 18: 63,257,713 (GRCm39) H335R possibly damaging Het
Pkn2 T C 3: 142,499,615 (GRCm39) Q954R probably damaging Het
Pramel23 C A 4: 143,424,840 (GRCm39) C201F probably benign Het
Prkcq G A 2: 11,237,442 (GRCm39) V74M probably damaging Het
Prkrip1 A T 5: 136,218,489 (GRCm39) probably null Het
Pttg1ip2 A T 5: 5,528,943 (GRCm39) I24N possibly damaging Het
Rb1cc1 A G 1: 6,284,904 (GRCm39) probably benign Het
Rbm5 A T 9: 107,644,763 (GRCm39) Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr3 C A 2: 112,690,805 (GRCm39) V1082L probably damaging Het
Scart2 A G 7: 139,877,178 (GRCm39) E831G probably benign Het
Sel1l3 C A 5: 53,327,789 (GRCm39) E497* probably null Het
Serpina6 A T 12: 103,620,182 (GRCm39) I189N probably damaging Het
Serpinb11 A T 1: 107,304,532 (GRCm39) T166S probably benign Het
Skint7 T C 4: 111,839,270 (GRCm39) L188S probably benign Het
Slc25a45 C T 19: 5,934,958 (GRCm39) A269V probably damaging Het
Sltm A G 9: 70,469,082 (GRCm39) T114A probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Spen C A 4: 141,200,261 (GRCm39) V2766L probably damaging Het
Srgap2 T A 1: 131,247,275 (GRCm39) I445F possibly damaging Het
Stox2 A T 8: 47,647,051 (GRCm39) Y200* probably null Het
Strada C A 11: 106,055,010 (GRCm39) R384L probably damaging Het
Tctn2 G A 5: 124,757,094 (GRCm39) noncoding transcript Het
Tgfbr3l G T 8: 4,299,282 (GRCm39) R461L probably benign Het
Tmem65 A G 15: 58,661,998 (GRCm39) probably benign Het
Tpst1 G T 5: 130,143,343 (GRCm39) V294F possibly damaging Het
Trim23 A G 13: 104,335,126 (GRCm39) Y384C probably damaging Het
Ubxn4 T A 1: 128,183,916 (GRCm39) V92E probably damaging Het
Vmn2r57 A T 7: 41,050,067 (GRCm39) C561S probably damaging Het
Vwa8 A G 14: 79,145,635 (GRCm39) D104G probably damaging Het
Wdr25 T A 12: 108,992,364 (GRCm39) L73* probably null Het
Wnt9a G A 11: 59,221,728 (GRCm39) A209T probably benign Het
Zcchc17 A C 4: 130,223,388 (GRCm39) C133G probably damaging Het
Zdhhc18 T A 4: 133,335,987 (GRCm39) M375L probably benign Het
Zfhx3 T C 8: 109,678,276 (GRCm39) F3109L probably benign Het
Zfp202 T A 9: 40,121,762 (GRCm39) D286E probably benign Het
Zzef1 T C 11: 72,784,158 (GRCm39) L2021P probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CAGTAACCGAGCCTCACTTAGCAG -3'
(R):5'- TTGATGTCCCCACCAAGTCCTAGC -3'

Sequencing Primer
(F):5'- AGAGCATCTGTCCAGTGTCAG -3'
(R):5'- GGAACAGTCACAGAAGAGCATC -3'
Posted On 2014-05-23