Incidental Mutation 'R1764:Ncor2'
ID 193275
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Name nuclear receptor co-repressor 2
Synonyms SMRT, SMRTe
MMRRC Submission 039796-MU
Accession Numbers

Ncbi RefSeq: NM_011424.3, NM_001253904.1, NM_001253905.1; MGI:1337080

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1764 (G1)
Quality Score 185
Status Validated
Chromosome 5
Chromosomal Location 125017153-125179219 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 125028615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 1637 (A1637D)
Ref Sequence ENSEMBL: ENSMUSP00000107025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402] [ENSMUST00000134404] [ENSMUST00000138890]
AlphaFold Q9WU42
Predicted Effect possibly damaging
Transcript: ENSMUST00000055256
AA Change: A1857D

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478
AA Change: A1857D

low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086083
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478

low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111393
AA Change: A1716D

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478
AA Change: A1716D

coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111394
AA Change: A1637D

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478
AA Change: A1637D

SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111398
AA Change: A1856D

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478
AA Change: A1856D

low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111402
AA Change: A1891D

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478
AA Change: A1891D

Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125053
SMART Domains Protein: ENSMUSP00000117098
Gene: ENSMUSG00000029478

low complexity region 36 47 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 133 143 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 563 579 N/A INTRINSIC
low complexity region 698 704 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
low complexity region 819 836 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1038 1054 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
PDB:2GPV|I 1372 1393 5e-8 PDB
low complexity region 1403 1415 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130742
Predicted Effect probably benign
Transcript: ENSMUST00000134404
SMART Domains Protein: ENSMUSP00000121588
Gene: ENSMUSG00000029478

SANT 2 49 1.94e-2 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 113 140 N/A INTRINSIC
low complexity region 182 227 N/A INTRINSIC
low complexity region 236 242 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 281 288 N/A INTRINSIC
low complexity region 319 333 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 424 438 N/A INTRINSIC
low complexity region 440 456 N/A INTRINSIC
low complexity region 499 509 N/A INTRINSIC
low complexity region 513 529 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134819
SMART Domains Protein: ENSMUSP00000115776
Gene: ENSMUSG00000029478

low complexity region 4 20 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138890
SMART Domains Protein: ENSMUSP00000117813
Gene: ENSMUSG00000029478

low complexity region 178 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200297
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype Strain: 3765904; 4329504
Lethality: E1-E16
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,478,943 I24N possibly damaging Het
4930522L14Rik A G 5: 109,736,789 V401A probably benign Het
5830411N06Rik A G 7: 140,297,265 E831G probably benign Het
9930021J03Rik T A 19: 29,719,160 T978S possibly damaging Het
Abca7 G T 10: 80,008,950 W1502L probably damaging Het
Adcy7 A G 8: 88,308,840 E124G probably benign Het
Aif1l G A 2: 31,965,106 E66K probably benign Het
Aldh8a1 A T 10: 21,395,493 M373L probably benign Het
Alg6 T C 4: 99,741,578 Y131H probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arrdc4 A T 7: 68,741,874 I215K probably damaging Het
Asb4 A G 6: 5,390,798 probably null Het
Astn1 T C 1: 158,504,251 I305T probably benign Het
Atp5b T A 10: 128,084,080 probably benign Het
Atp8a1 C A 5: 67,631,567 M1044I probably benign Het
Atp9b C T 18: 80,909,591 probably null Het
Btaf1 A G 19: 36,951,118 H113R probably benign Het
C87436 G T 6: 86,453,612 C338F possibly damaging Het
Casz1 T C 4: 148,942,900 probably benign Het
Cbr3 T A 16: 93,690,482 H184Q probably damaging Het
Cct8l1 T C 5: 25,517,099 S271P possibly damaging Het
Cdc34 A G 10: 79,685,340 K77R probably benign Het
Cdc34 G T 10: 79,685,338 probably null Het
Cdh20 A G 1: 104,934,345 probably benign Het
Celsr3 A G 9: 108,828,958 E880G probably damaging Het
Cers1 T G 8: 70,321,491 probably null Het
Cntn5 T C 9: 9,673,983 I705V probably benign Het
Dennd4c T A 4: 86,803,010 D636E probably damaging Het
Dnah11 T C 12: 118,190,825 E240G probably benign Het
Dnah2 T C 11: 69,423,543 Y4100C probably damaging Het
Dpysl3 T C 18: 43,363,518 E151G probably damaging Het
Efcab9 T G 11: 32,524,457 T9P possibly damaging Het
Eif4g2 A T 7: 111,074,487 F725Y probably damaging Het
Epha6 T A 16: 59,775,728 I867F probably null Het
Erbin T C 13: 103,843,451 probably benign Het
Evi5l A G 8: 4,203,560 E468G probably damaging Het
Filip1l C T 16: 57,570,038 R330W probably damaging Het
Fmo3 C T 1: 162,958,573 V283M possibly damaging Het
Gabarapl1 A T 6: 129,533,518 K24N possibly damaging Het
Gigyf1 C T 5: 137,522,508 probably benign Het
Gm13089 C A 4: 143,698,270 C201F probably benign Het
Gm5581 T A 6: 131,181,399 noncoding transcript Het
Gon4l G T 3: 88,892,599 K850N probably damaging Het
Igf2bp3 C T 6: 49,109,046 R233H probably damaging Het
Iqcf4 G A 9: 106,568,694 R85C probably benign Het
Kalrn C T 16: 34,212,873 R473Q probably damaging Het
Lmod2 T A 6: 24,603,377 V117E probably damaging Het
Mapk11 A G 15: 89,144,391 probably null Het
Mcm3 G A 1: 20,805,879 R664C probably damaging Het
Mex3d A G 10: 80,386,936 M162T probably benign Het
Mrgprb3 A G 7: 48,643,023 I260T probably benign Het
Nedd4 T A 9: 72,730,907 D441E probably damaging Het
Nek5 A T 8: 22,109,912 C194S probably damaging Het
Nos1ap T C 1: 170,318,878 D369G possibly damaging Het
Ntrk1 G T 3: 87,780,084 T681K probably damaging Het
Olfr1306 A G 2: 111,912,181 F250L possibly damaging Het
Olfr538 T C 7: 140,574,470 W106R probably damaging Het
Otogl C T 10: 107,899,461 W154* probably null Het
Pcdh20 T C 14: 88,469,184 T227A possibly damaging Het
Pcdhb17 T C 18: 37,487,271 S705P probably damaging Het
Piezo2 T C 18: 63,124,642 H335R possibly damaging Het
Pkn2 T C 3: 142,793,854 Q954R probably damaging Het
Prkcq G A 2: 11,232,631 V74M probably damaging Het
Prkrip1 A T 5: 136,189,635 probably null Het
Rb1cc1 A G 1: 6,214,680 probably benign Het
Rbm5 A T 9: 107,767,564 Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr3 C A 2: 112,860,460 V1082L probably damaging Het
Sel1l3 C A 5: 53,170,447 E497* probably null Het
Serpina6 A T 12: 103,653,923 I189N probably damaging Het
Serpinb11 A T 1: 107,376,802 T166S probably benign Het
Skint7 T C 4: 111,982,073 L188S probably benign Het
Slc25a45 C T 19: 5,884,930 A269V probably damaging Het
Sltm A G 9: 70,561,800 T114A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spen C A 4: 141,472,950 V2766L probably damaging Het
Srgap2 T A 1: 131,319,537 I445F possibly damaging Het
Stox2 A T 8: 47,194,016 Y200* probably null Het
Strada C A 11: 106,164,184 R384L probably damaging Het
Tctn2 G A 5: 124,619,031 noncoding transcript Het
Tgfbr3l G T 8: 4,249,282 R461L probably benign Het
Tmem65 A G 15: 58,790,149 probably benign Het
Tpst1 G T 5: 130,114,502 V294F possibly damaging Het
Trim23 A G 13: 104,198,618 Y384C probably damaging Het
Ube3b C G 5: 114,404,617 L512V possibly damaging Het
Ubxn4 T A 1: 128,256,179 V92E probably damaging Het
Vmn2r57 A T 7: 41,400,643 C561S probably damaging Het
Vwa8 A G 14: 78,908,195 D104G probably damaging Het
Wdr25 T A 12: 109,026,438 L73* probably null Het
Wnt9a G A 11: 59,330,902 A209T probably benign Het
Zcchc17 A C 4: 130,329,595 C133G probably damaging Het
Zdhhc18 T A 4: 133,608,676 M375L probably benign Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfp202 T A 9: 40,210,466 D286E probably benign Het
Zzef1 T C 11: 72,893,332 L2021P probably benign Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125042743 critical splice donor site probably null
IGL00519:Ncor2 APN 5 125084924 missense unknown
IGL00900:Ncor2 APN 5 125025784 missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125086890 missense unknown
IGL01320:Ncor2 APN 5 125109927 missense probably benign 0.00
IGL01382:Ncor2 APN 5 125055773 missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125085026 missense unknown
IGL01721:Ncor2 APN 5 125050937 missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125065870 missense unknown
IGL02090:Ncor2 APN 5 125034403 missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125024237 missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125037914 missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125025557 missense probably benign 0.33
IGL02997:Ncor2 APN 5 125119570 intron probably benign
R0019:Ncor2 UTSW 5 125119481 critical splice donor site probably null
R0331:Ncor2 UTSW 5 125084917 missense unknown
R0333:Ncor2 UTSW 5 125034344 splice site probably benign
R0403:Ncor2 UTSW 5 125033337 missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125106305 nonsense probably null
R0562:Ncor2 UTSW 5 125085029 missense unknown
R0671:Ncor2 UTSW 5 125049387 missense probably benign 0.13
R0699:Ncor2 UTSW 5 125029112 unclassified probably benign
R0865:Ncor2 UTSW 5 125038982 missense probably benign 0.17
R1183:Ncor2 UTSW 5 125023521 missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125118780 intron probably benign
R1344:Ncor2 UTSW 5 125025446 missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125109975 intron probably benign
R1481:Ncor2 UTSW 5 125027138 nonsense probably null
R1539:Ncor2 UTSW 5 125109939 missense probably benign 0.07
R1558:Ncor2 UTSW 5 125033546 missense probably damaging 1.00
R1585:Ncor2 UTSW 5 125084998 missense unknown
R1611:Ncor2 UTSW 5 125110020 intron probably benign
R1789:Ncor2 UTSW 5 125019890 missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125118793 intron probably benign
R1901:Ncor2 UTSW 5 125025425 missense probably benign 0.39
R1946:Ncor2 UTSW 5 125034412 missense probably damaging 1.00
R1970:Ncor2 UTSW 5 125038918 missense probably damaging 0.99
R2048:Ncor2 UTSW 5 125084932 missense unknown
R2137:Ncor2 UTSW 5 125030712 missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125037955 missense probably benign 0.33
R2380:Ncor2 UTSW 5 125036080 missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125028800 critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125025760 missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125024166 missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125028687 missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125118692 intron probably benign
R3829:Ncor2 UTSW 5 125118692 intron probably benign
R3830:Ncor2 UTSW 5 125118692 intron probably benign
R3951:Ncor2 UTSW 5 125032256 missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125050956 missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125028972 missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125102641 critical splice donor site probably null
R4490:Ncor2 UTSW 5 125036815 splice site probably null
R4573:Ncor2 UTSW 5 125055825 missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125030859 missense probably damaging 1.00
R4799:Ncor2 UTSW 5 125037060 critical splice donor site probably null
R4851:Ncor2 UTSW 5 125033367 missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125025105 missense probably damaging 0.99
R4853:Ncor2 UTSW 5 125081183 missense unknown
R4896:Ncor2 UTSW 5 125049340 critical splice donor site probably null
R4997:Ncor2 UTSW 5 125034010 missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125048066 missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125026930 missense probably benign 0.44
R5461:Ncor2 UTSW 5 125027113 missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125067911 nonsense probably null
R5638:Ncor2 UTSW 5 125048300 missense probably benign 0.33
R5879:Ncor2 UTSW 5 125026775 unclassified probably benign
R5967:Ncor2 UTSW 5 125068984 missense unknown
R5999:Ncor2 UTSW 5 125033441 missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125020011 missense probably benign 0.14
R6109:Ncor2 UTSW 5 125055846 missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125087902 missense unknown
R6462:Ncor2 UTSW 5 125024172 missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125110005 intron probably benign
R7074:Ncor2 UTSW 5 125049366 nonsense probably null
R7179:Ncor2 UTSW 5 125055783 missense unknown
R7261:Ncor2 UTSW 5 125110079 splice site probably null
R7263:Ncor2 UTSW 5 125032132 missense
R7273:Ncor2 UTSW 5 125023623 missense
R7282:Ncor2 UTSW 5 125020040 missense
R7570:Ncor2 UTSW 5 125030089 missense
R7725:Ncor2 UTSW 5 125023566 missense
R7747:Ncor2 UTSW 5 125027038 missense
R7748:Ncor2 UTSW 5 125109967 missense unknown
R7825:Ncor2 UTSW 5 125037077 missense possibly damaging 0.53
R8008:Ncor2 UTSW 5 125067919 missense unknown
R8126:Ncor2 UTSW 5 125106204 missense unknown
R8137:Ncor2 UTSW 5 125037893 missense
R8706:Ncor2 UTSW 5 125067946 missense unknown
R8751:Ncor2 UTSW 5 125038900 missense
R8819:Ncor2 UTSW 5 125029227 missense
R8820:Ncor2 UTSW 5 125029227 missense
R8824:Ncor2 UTSW 5 125118757 missense
R8867:Ncor2 UTSW 5 125102675 missense unknown
R8919:Ncor2 UTSW 5 125029189 missense
R8922:Ncor2 UTSW 5 125086875 missense unknown
R9076:Ncor2 UTSW 5 125034022 missense
R9249:Ncor2 UTSW 5 125109924 missense unknown
R9276:Ncor2 UTSW 5 125036086 missense
R9362:Ncor2 UTSW 5 125018201 missense
R9667:Ncor2 UTSW 5 125048481 missense unknown
R9684:Ncor2 UTSW 5 125025075 missense
Z1088:Ncor2 UTSW 5 125067788 missense unknown
Z1088:Ncor2 UTSW 5 125086840 critical splice donor site probably null
Z1177:Ncor2 UTSW 5 125036849 missense
Z1177:Ncor2 UTSW 5 125047994 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccatccatccatccatccatc -3'
Posted On 2014-05-23