Incidental Mutation 'R1764:Aldh8a1'
ID 193308
Institutional Source Beutler Lab
Gene Symbol Aldh8a1
Ensembl Gene ENSMUSG00000037542
Gene Name aldehyde dehydrogenase 8 family, member A1
Synonyms RALDH4
MMRRC Submission 039796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R1764 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 21253199-21272477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21271392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 373 (M373L)
Ref Sequence ENSEMBL: ENSMUSP00000038878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042699]
AlphaFold Q8BH00
Predicted Effect probably benign
Transcript: ENSMUST00000042699
AA Change: M373L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000038878
Gene: ENSMUSG00000037542
AA Change: M373L

DomainStartEndE-ValueType
Pfam:Aldedh 19 483 8.6e-170 PFAM
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. It plays a role in a pathway of 9-cis-retinoic acid biosynthesis in vivo. This enzyme converts 9-cis-retinal into the retinoid X receptor ligand 9-cis-retinoic acid, and has approximately 40-fold higher activity with 9-cis-retinal than with all-trans-retinal. Therefore, it is the first known aldehyde dehydrogenase to show a preference for 9-cis-retinal relative to all-trans-retinal. Three transcript variants encoding distinct protein isoforms have been identified for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,884,655 (GRCm39) V401A probably benign Het
Abca7 G T 10: 79,844,784 (GRCm39) W1502L probably damaging Het
Adcy7 A G 8: 89,035,468 (GRCm39) E124G probably benign Het
Aif1l G A 2: 31,855,118 (GRCm39) E66K probably benign Het
Alg6 T C 4: 99,629,815 (GRCm39) Y131H probably benign Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Arrdc4 A T 7: 68,391,622 (GRCm39) I215K probably damaging Het
Asb4 A G 6: 5,390,798 (GRCm39) probably null Het
Astn1 T C 1: 158,331,821 (GRCm39) I305T probably benign Het
Atp5f1b T A 10: 127,919,949 (GRCm39) probably benign Het
Atp8a1 C A 5: 67,788,910 (GRCm39) M1044I probably benign Het
Atp9b C T 18: 80,952,806 (GRCm39) probably null Het
Brd10 T A 19: 29,696,560 (GRCm39) T978S possibly damaging Het
Btaf1 A G 19: 36,928,518 (GRCm39) H113R probably benign Het
C87436 G T 6: 86,430,594 (GRCm39) C338F possibly damaging Het
Casz1 T C 4: 149,027,357 (GRCm39) probably benign Het
Cbr3 T A 16: 93,487,370 (GRCm39) H184Q probably damaging Het
Cct8l1 T C 5: 25,722,097 (GRCm39) S271P possibly damaging Het
Cdc34 A G 10: 79,521,174 (GRCm39) K77R probably benign Het
Cdc34 G T 10: 79,521,172 (GRCm39) probably null Het
Cdh20 A G 1: 104,862,070 (GRCm39) probably benign Het
Celsr3 A G 9: 108,706,157 (GRCm39) E880G probably damaging Het
Cers1 T G 8: 70,774,141 (GRCm39) probably null Het
Cntn5 T C 9: 9,673,988 (GRCm39) I705V probably benign Het
Dennd4c T A 4: 86,721,247 (GRCm39) D636E probably damaging Het
Dnah11 T C 12: 118,154,560 (GRCm39) E240G probably benign Het
Dnah2 T C 11: 69,314,369 (GRCm39) Y4100C probably damaging Het
Dpysl3 T C 18: 43,496,583 (GRCm39) E151G probably damaging Het
Efcab9 T G 11: 32,474,457 (GRCm39) T9P possibly damaging Het
Eif4g2 A T 7: 110,673,694 (GRCm39) F725Y probably damaging Het
Epha6 T A 16: 59,596,091 (GRCm39) I867F probably null Het
Erbin T C 13: 103,979,959 (GRCm39) probably benign Het
Evi5l A G 8: 4,253,560 (GRCm39) E468G probably damaging Het
Filip1l C T 16: 57,390,401 (GRCm39) R330W probably damaging Het
Fmo3 C T 1: 162,786,142 (GRCm39) V283M possibly damaging Het
Gabarapl1 A T 6: 129,510,481 (GRCm39) K24N possibly damaging Het
Gigyf1 C T 5: 137,520,770 (GRCm39) probably benign Het
Gm5581 T A 6: 131,158,362 (GRCm39) noncoding transcript Het
Gon4l G T 3: 88,799,906 (GRCm39) K850N probably damaging Het
Igf2bp3 C T 6: 49,085,980 (GRCm39) R233H probably damaging Het
Iqcf4 G A 9: 106,445,893 (GRCm39) R85C probably benign Het
Kalrn C T 16: 34,033,243 (GRCm39) R473Q probably damaging Het
Lmod2 T A 6: 24,603,376 (GRCm39) V117E probably damaging Het
Mapk11 A G 15: 89,028,594 (GRCm39) probably null Het
Mcm3 G A 1: 20,876,103 (GRCm39) R664C probably damaging Het
Mex3d A G 10: 80,222,770 (GRCm39) M162T probably benign Het
Mrgprb3 A G 7: 48,292,771 (GRCm39) I260T probably benign Het
Ncor2 G T 5: 125,105,679 (GRCm39) A1637D possibly damaging Het
Nedd4 T A 9: 72,638,189 (GRCm39) D441E probably damaging Het
Nek5 A T 8: 22,599,928 (GRCm39) C194S probably damaging Het
Nos1ap T C 1: 170,146,447 (GRCm39) D369G possibly damaging Het
Ntrk1 G T 3: 87,687,391 (GRCm39) T681K probably damaging Het
Or13a24 T C 7: 140,154,383 (GRCm39) W106R probably damaging Het
Or4f14 A G 2: 111,742,526 (GRCm39) F250L possibly damaging Het
Otogl C T 10: 107,735,322 (GRCm39) W154* probably null Het
Pcdh20 T C 14: 88,706,620 (GRCm39) T227A possibly damaging Het
Pcdhb17 T C 18: 37,620,324 (GRCm39) S705P probably damaging Het
Piezo2 T C 18: 63,257,713 (GRCm39) H335R possibly damaging Het
Pkn2 T C 3: 142,499,615 (GRCm39) Q954R probably damaging Het
Pramel23 C A 4: 143,424,840 (GRCm39) C201F probably benign Het
Prkcq G A 2: 11,237,442 (GRCm39) V74M probably damaging Het
Prkrip1 A T 5: 136,218,489 (GRCm39) probably null Het
Pttg1ip2 A T 5: 5,528,943 (GRCm39) I24N possibly damaging Het
Rb1cc1 A G 1: 6,284,904 (GRCm39) probably benign Het
Rbm5 A T 9: 107,644,763 (GRCm39) Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr3 C A 2: 112,690,805 (GRCm39) V1082L probably damaging Het
Scart2 A G 7: 139,877,178 (GRCm39) E831G probably benign Het
Sel1l3 C A 5: 53,327,789 (GRCm39) E497* probably null Het
Serpina6 A T 12: 103,620,182 (GRCm39) I189N probably damaging Het
Serpinb11 A T 1: 107,304,532 (GRCm39) T166S probably benign Het
Skint7 T C 4: 111,839,270 (GRCm39) L188S probably benign Het
Slc25a45 C T 19: 5,934,958 (GRCm39) A269V probably damaging Het
Sltm A G 9: 70,469,082 (GRCm39) T114A probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Spen C A 4: 141,200,261 (GRCm39) V2766L probably damaging Het
Srgap2 T A 1: 131,247,275 (GRCm39) I445F possibly damaging Het
Stox2 A T 8: 47,647,051 (GRCm39) Y200* probably null Het
Strada C A 11: 106,055,010 (GRCm39) R384L probably damaging Het
Tctn2 G A 5: 124,757,094 (GRCm39) noncoding transcript Het
Tgfbr3l G T 8: 4,299,282 (GRCm39) R461L probably benign Het
Tmem65 A G 15: 58,661,998 (GRCm39) probably benign Het
Tpst1 G T 5: 130,143,343 (GRCm39) V294F possibly damaging Het
Trim23 A G 13: 104,335,126 (GRCm39) Y384C probably damaging Het
Ube3b C G 5: 114,542,678 (GRCm39) L512V possibly damaging Het
Ubxn4 T A 1: 128,183,916 (GRCm39) V92E probably damaging Het
Vmn2r57 A T 7: 41,050,067 (GRCm39) C561S probably damaging Het
Vwa8 A G 14: 79,145,635 (GRCm39) D104G probably damaging Het
Wdr25 T A 12: 108,992,364 (GRCm39) L73* probably null Het
Wnt9a G A 11: 59,221,728 (GRCm39) A209T probably benign Het
Zcchc17 A C 4: 130,223,388 (GRCm39) C133G probably damaging Het
Zdhhc18 T A 4: 133,335,987 (GRCm39) M375L probably benign Het
Zfhx3 T C 8: 109,678,276 (GRCm39) F3109L probably benign Het
Zfp202 T A 9: 40,121,762 (GRCm39) D286E probably benign Het
Zzef1 T C 11: 72,784,158 (GRCm39) L2021P probably benign Het
Other mutations in Aldh8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Aldh8a1 APN 10 21,271,329 (GRCm39) missense probably damaging 0.98
IGL01095:Aldh8a1 APN 10 21,265,180 (GRCm39) missense probably benign 0.18
IGL01525:Aldh8a1 APN 10 21,267,472 (GRCm39) missense probably damaging 0.98
IGL02206:Aldh8a1 APN 10 21,271,474 (GRCm39) missense probably benign 0.00
IGL02232:Aldh8a1 APN 10 21,271,545 (GRCm39) missense probably damaging 1.00
IGL03213:Aldh8a1 APN 10 21,260,616 (GRCm39) missense probably damaging 0.97
R0105:Aldh8a1 UTSW 10 21,271,438 (GRCm39) missense probably damaging 0.99
R0105:Aldh8a1 UTSW 10 21,271,438 (GRCm39) missense probably damaging 0.99
R0893:Aldh8a1 UTSW 10 21,267,593 (GRCm39) missense probably benign 0.19
R1168:Aldh8a1 UTSW 10 21,260,530 (GRCm39) splice site probably null
R4016:Aldh8a1 UTSW 10 21,271,470 (GRCm39) missense probably benign 0.00
R4464:Aldh8a1 UTSW 10 21,264,840 (GRCm39) intron probably benign
R4915:Aldh8a1 UTSW 10 21,271,662 (GRCm39) missense probably damaging 1.00
R5816:Aldh8a1 UTSW 10 21,271,329 (GRCm39) missense probably damaging 0.98
R6032:Aldh8a1 UTSW 10 21,264,970 (GRCm39) missense probably benign 0.29
R6032:Aldh8a1 UTSW 10 21,264,970 (GRCm39) missense probably benign 0.29
R6581:Aldh8a1 UTSW 10 21,256,741 (GRCm39) missense probably damaging 1.00
R7422:Aldh8a1 UTSW 10 21,264,996 (GRCm39) missense possibly damaging 0.74
R7458:Aldh8a1 UTSW 10 21,271,492 (GRCm39) missense possibly damaging 0.95
R7574:Aldh8a1 UTSW 10 21,256,729 (GRCm39) missense possibly damaging 0.78
R8014:Aldh8a1 UTSW 10 21,265,201 (GRCm39) missense probably benign 0.03
R8150:Aldh8a1 UTSW 10 21,271,444 (GRCm39) missense probably damaging 1.00
R8151:Aldh8a1 UTSW 10 21,271,465 (GRCm39) missense probably damaging 0.97
R8160:Aldh8a1 UTSW 10 21,271,690 (GRCm39) missense possibly damaging 0.89
R9058:Aldh8a1 UTSW 10 21,258,344 (GRCm39) missense possibly damaging 0.50
R9250:Aldh8a1 UTSW 10 21,258,259 (GRCm39) missense probably damaging 0.98
R9451:Aldh8a1 UTSW 10 21,265,032 (GRCm39) missense probably benign
R9578:Aldh8a1 UTSW 10 21,253,281 (GRCm39) missense probably damaging 1.00
X0011:Aldh8a1 UTSW 10 21,265,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGAAACACCCAACGGTAAGAG -3'
(R):5'- GTTGACTGCACTGACAAGCGATTC -3'

Sequencing Primer
(F):5'- TTGAAAGCTCAGACTGAGGG -3'
(R):5'- ACAAGCGATTCTCTGCTGG -3'
Posted On 2014-05-23