Incidental Mutation 'R1764:Piezo2'
ID 193335
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 039796-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1764 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63124642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 335 (H335R)
Ref Sequence ENSEMBL: ENSMUSP00000036099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046860
AA Change: H335R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: H335R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047480
AA Change: H335R

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: H335R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182166
AA Change: H227R

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182177
Predicted Effect probably benign
Transcript: ENSMUST00000182233
AA Change: H103R

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: H103R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183217
AA Change: H335R

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: H335R

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.3266 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,789 (GRCm38) V401A probably benign Het
Abca7 G T 10: 80,008,950 (GRCm38) W1502L probably damaging Het
Adcy7 A G 8: 88,308,840 (GRCm38) E124G probably benign Het
Aif1l G A 2: 31,965,106 (GRCm38) E66K probably benign Het
Aldh8a1 A T 10: 21,395,493 (GRCm38) M373L probably benign Het
Alg6 T C 4: 99,741,578 (GRCm38) Y131H probably benign Het
Arhgef6 T C X: 57,338,562 (GRCm38) M5V probably benign Het
Arrdc4 A T 7: 68,741,874 (GRCm38) I215K probably damaging Het
Asb4 A G 6: 5,390,798 (GRCm38) probably null Het
Astn1 T C 1: 158,504,251 (GRCm38) I305T probably benign Het
Atp5f1b T A 10: 128,084,080 (GRCm38) probably benign Het
Atp8a1 C A 5: 67,631,567 (GRCm38) M1044I probably benign Het
Atp9b C T 18: 80,909,591 (GRCm38) probably null Het
Brd10 T A 19: 29,719,160 (GRCm38) T978S possibly damaging Het
Btaf1 A G 19: 36,951,118 (GRCm38) H113R probably benign Het
C87436 G T 6: 86,453,612 (GRCm38) C338F possibly damaging Het
Casz1 T C 4: 148,942,900 (GRCm38) probably benign Het
Cbr3 T A 16: 93,690,482 (GRCm38) H184Q probably damaging Het
Cct8l1 T C 5: 25,517,099 (GRCm38) S271P possibly damaging Het
Cdc34 G T 10: 79,685,338 (GRCm38) probably null Het
Cdc34 A G 10: 79,685,340 (GRCm38) K77R probably benign Het
Cdh20 A G 1: 104,934,345 (GRCm38) probably benign Het
Celsr3 A G 9: 108,828,958 (GRCm38) E880G probably damaging Het
Cers1 T G 8: 70,321,491 (GRCm38) probably null Het
Cntn5 T C 9: 9,673,983 (GRCm38) I705V probably benign Het
Dennd4c T A 4: 86,803,010 (GRCm38) D636E probably damaging Het
Dnah11 T C 12: 118,190,825 (GRCm38) E240G probably benign Het
Dnah2 T C 11: 69,423,543 (GRCm38) Y4100C probably damaging Het
Dpysl3 T C 18: 43,363,518 (GRCm38) E151G probably damaging Het
Efcab9 T G 11: 32,524,457 (GRCm38) T9P possibly damaging Het
Eif4g2 A T 7: 111,074,487 (GRCm38) F725Y probably damaging Het
Epha6 T A 16: 59,775,728 (GRCm38) I867F probably null Het
Erbin T C 13: 103,843,451 (GRCm38) probably benign Het
Evi5l A G 8: 4,203,560 (GRCm38) E468G probably damaging Het
Filip1l C T 16: 57,570,038 (GRCm38) R330W probably damaging Het
Fmo3 C T 1: 162,958,573 (GRCm38) V283M possibly damaging Het
Gabarapl1 A T 6: 129,533,518 (GRCm38) K24N possibly damaging Het
Gigyf1 C T 5: 137,522,508 (GRCm38) probably benign Het
Gm5581 T A 6: 131,181,399 (GRCm38) noncoding transcript Het
Gon4l G T 3: 88,892,599 (GRCm38) K850N probably damaging Het
Igf2bp3 C T 6: 49,109,046 (GRCm38) R233H probably damaging Het
Iqcf4 G A 9: 106,568,694 (GRCm38) R85C probably benign Het
Kalrn C T 16: 34,212,873 (GRCm38) R473Q probably damaging Het
Lmod2 T A 6: 24,603,377 (GRCm38) V117E probably damaging Het
Mapk11 A G 15: 89,144,391 (GRCm38) probably null Het
Mcm3 G A 1: 20,805,879 (GRCm38) R664C probably damaging Het
Mex3d A G 10: 80,386,936 (GRCm38) M162T probably benign Het
Mrgprb3 A G 7: 48,643,023 (GRCm38) I260T probably benign Het
Ncor2 G T 5: 125,028,615 (GRCm38) A1637D possibly damaging Het
Nedd4 T A 9: 72,730,907 (GRCm38) D441E probably damaging Het
Nek5 A T 8: 22,109,912 (GRCm38) C194S probably damaging Het
Nos1ap T C 1: 170,318,878 (GRCm38) D369G possibly damaging Het
Ntrk1 G T 3: 87,780,084 (GRCm38) T681K probably damaging Het
Or13a24 T C 7: 140,574,470 (GRCm38) W106R probably damaging Het
Or4f14 A G 2: 111,912,181 (GRCm38) F250L possibly damaging Het
Otogl C T 10: 107,899,461 (GRCm38) W154* probably null Het
Pcdh20 T C 14: 88,469,184 (GRCm38) T227A possibly damaging Het
Pcdhb17 T C 18: 37,487,271 (GRCm38) S705P probably damaging Het
Pkn2 T C 3: 142,793,854 (GRCm38) Q954R probably damaging Het
Pramel23 C A 4: 143,698,270 (GRCm38) C201F probably benign Het
Prkcq G A 2: 11,232,631 (GRCm38) V74M probably damaging Het
Prkrip1 A T 5: 136,189,635 (GRCm38) probably null Het
Pttg1ip2 A T 5: 5,478,943 (GRCm38) I24N possibly damaging Het
Rb1cc1 A G 1: 6,214,680 (GRCm38) probably benign Het
Rbm5 A T 9: 107,767,564 (GRCm38) Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 (GRCm38) probably benign Het
Ryr3 C A 2: 112,860,460 (GRCm38) V1082L probably damaging Het
Scart2 A G 7: 140,297,265 (GRCm38) E831G probably benign Het
Sel1l3 C A 5: 53,170,447 (GRCm38) E497* probably null Het
Serpina6 A T 12: 103,653,923 (GRCm38) I189N probably damaging Het
Serpinb11 A T 1: 107,376,802 (GRCm38) T166S probably benign Het
Skint7 T C 4: 111,982,073 (GRCm38) L188S probably benign Het
Slc25a45 C T 19: 5,884,930 (GRCm38) A269V probably damaging Het
Sltm A G 9: 70,561,800 (GRCm38) T114A probably benign Het
Sned1 G A 1: 93,281,654 (GRCm38) V830M possibly damaging Het
Spen C A 4: 141,472,950 (GRCm38) V2766L probably damaging Het
Srgap2 T A 1: 131,319,537 (GRCm38) I445F possibly damaging Het
Stox2 A T 8: 47,194,016 (GRCm38) Y200* probably null Het
Strada C A 11: 106,164,184 (GRCm38) R384L probably damaging Het
Tctn2 G A 5: 124,619,031 (GRCm38) noncoding transcript Het
Tgfbr3l G T 8: 4,249,282 (GRCm38) R461L probably benign Het
Tmem65 A G 15: 58,790,149 (GRCm38) probably benign Het
Tpst1 G T 5: 130,114,502 (GRCm38) V294F possibly damaging Het
Trim23 A G 13: 104,198,618 (GRCm38) Y384C probably damaging Het
Ube3b C G 5: 114,404,617 (GRCm38) L512V possibly damaging Het
Ubxn4 T A 1: 128,256,179 (GRCm38) V92E probably damaging Het
Vmn2r57 A T 7: 41,400,643 (GRCm38) C561S probably damaging Het
Vwa8 A G 14: 78,908,195 (GRCm38) D104G probably damaging Het
Wdr25 T A 12: 109,026,438 (GRCm38) L73* probably null Het
Wnt9a G A 11: 59,330,902 (GRCm38) A209T probably benign Het
Zcchc17 A C 4: 130,329,595 (GRCm38) C133G probably damaging Het
Zdhhc18 T A 4: 133,608,676 (GRCm38) M375L probably benign Het
Zfhx3 T C 8: 108,951,644 (GRCm38) F3109L probably benign Het
Zfp202 T A 9: 40,210,466 (GRCm38) D286E probably benign Het
Zzef1 T C 11: 72,893,332 (GRCm38) L2021P probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,117,699 (GRCm38) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,022,460 (GRCm38) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,070,030 (GRCm38) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,124,614 (GRCm38) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,030,392 (GRCm38) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,182,833 (GRCm38) splice site probably benign
IGL01674:Piezo2 APN 18 63,027,559 (GRCm38) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,083,170 (GRCm38) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,042,788 (GRCm38) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,092,844 (GRCm38) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,020,634 (GRCm38) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,146,844 (GRCm38) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,072,862 (GRCm38) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,032,924 (GRCm38) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,024,475 (GRCm38) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,074,659 (GRCm38) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,064,785 (GRCm38) splice site probably benign
IGL03011:Piezo2 APN 18 63,124,660 (GRCm38) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,070,075 (GRCm38) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,030,272 (GRCm38) splice site probably null
IGL03129:Piezo2 APN 18 63,114,972 (GRCm38) missense probably benign
IGL03143:Piezo2 APN 18 63,108,076 (GRCm38) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,011,598 (GRCm38) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,124,606 (GRCm38) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,053,062 (GRCm38) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,041,720 (GRCm38) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,011,538 (GRCm38) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,021,308 (GRCm38) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,027,704 (GRCm38) missense probably damaging 1.00
Piccolo UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
sopranino UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
woodwind UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,386,200 (GRCm38) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,024,469 (GRCm38) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,102,084 (GRCm38) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,024,491 (GRCm38) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,029,061 (GRCm38) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,102,174 (GRCm38) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,024,451 (GRCm38) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,027,544 (GRCm38) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,022,481 (GRCm38) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,022,426 (GRCm38) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,019,258 (GRCm38) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,041,723 (GRCm38) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,083,235 (GRCm38) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,015,802 (GRCm38) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,086,753 (GRCm38) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,021,254 (GRCm38) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,083,131 (GRCm38) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,144,919 (GRCm38) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,082,915 (GRCm38) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,117,672 (GRCm38) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,021,173 (GRCm38) missense probably damaging 1.00
R1793:Piezo2 UTSW 18 63,106,284 (GRCm38) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,108,087 (GRCm38) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,032,840 (GRCm38) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,019,344 (GRCm38) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,113,960 (GRCm38) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,078,840 (GRCm38) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,078,781 (GRCm38) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,144,926 (GRCm38) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,059,744 (GRCm38) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,118,935 (GRCm38) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,081,734 (GRCm38) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,117,720 (GRCm38) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,114,041 (GRCm38) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,106,274 (GRCm38) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,022,525 (GRCm38) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,245,624 (GRCm38) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,053,035 (GRCm38) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,146,843 (GRCm38) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,024,435 (GRCm38) nonsense probably null
R3016:Piezo2 UTSW 18 63,042,832 (GRCm38) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,081,793 (GRCm38) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,050,604 (GRCm38) missense probably benign
R4181:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,084,840 (GRCm38) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,102,099 (GRCm38) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,114,063 (GRCm38) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,072,880 (GRCm38) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,086,628 (GRCm38) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,069,963 (GRCm38) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,144,954 (GRCm38) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,078,791 (GRCm38) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,157,262 (GRCm38) missense probably benign
R4961:Piezo2 UTSW 18 63,052,961 (GRCm38) splice site probably null
R4968:Piezo2 UTSW 18 63,144,971 (GRCm38) nonsense probably null
R4973:Piezo2 UTSW 18 63,074,680 (GRCm38) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,083,113 (GRCm38) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,024,536 (GRCm38) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,074,620 (GRCm38) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,030,409 (GRCm38) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,032,929 (GRCm38) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,064,731 (GRCm38) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,084,740 (GRCm38) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,145,105 (GRCm38) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,027,864 (GRCm38) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,011,721 (GRCm38) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,145,091 (GRCm38) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,117,697 (GRCm38) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,117,696 (GRCm38) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,146,856 (GRCm38) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,027,901 (GRCm38) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,113,934 (GRCm38) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6073:Piezo2 UTSW 18 63,012,645 (GRCm38) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,157,210 (GRCm38) nonsense probably null
R6255:Piezo2 UTSW 18 63,121,270 (GRCm38) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,117,678 (GRCm38) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,106,293 (GRCm38) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,086,607 (GRCm38) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,041,663 (GRCm38) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,106,271 (GRCm38) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,021,328 (GRCm38) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,021,262 (GRCm38) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,032,889 (GRCm38) nonsense probably null
R6855:Piezo2 UTSW 18 63,090,879 (GRCm38) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,032,986 (GRCm38) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,082,961 (GRCm38) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,145,110 (GRCm38) nonsense probably null
R7162:Piezo2 UTSW 18 63,124,709 (GRCm38) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,108,030 (GRCm38) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,017,519 (GRCm38) splice site probably null
R7395:Piezo2 UTSW 18 63,027,563 (GRCm38) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,024,472 (GRCm38) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,012,723 (GRCm38) missense probably benign
R7517:Piezo2 UTSW 18 63,082,925 (GRCm38) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,053,010 (GRCm38) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,042,539 (GRCm38) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,113,876 (GRCm38) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,082,945 (GRCm38) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,083,200 (GRCm38) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,042,811 (GRCm38) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,030,466 (GRCm38) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,075,730 (GRCm38) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,012,786 (GRCm38) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,084,688 (GRCm38) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,045,540 (GRCm38) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,146,802 (GRCm38) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,092,900 (GRCm38) nonsense probably null
R8708:Piezo2 UTSW 18 63,093,015 (GRCm38) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8727:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8810:Piezo2 UTSW 18 63,114,963 (GRCm38) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,115,025 (GRCm38) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,092,831 (GRCm38) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,045,479 (GRCm38) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,117,744 (GRCm38) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,157,231 (GRCm38) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,021,301 (GRCm38) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,075,797 (GRCm38) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,024,566 (GRCm38) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,029,085 (GRCm38) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,102,165 (GRCm38) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,386,276 (GRCm38) start gained probably benign
R9608:Piezo2 UTSW 18 63,146,945 (GRCm38) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,115,037 (GRCm38) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,064,696 (GRCm38) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,027,586 (GRCm38) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,050,610 (GRCm38) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,017,577 (GRCm38) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,069,994 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCGATGCCAGAACACATATCTCTC -3'
(R):5'- AGCTGTGTACCTAGTCTCAGATGCC -3'

Sequencing Primer
(F):5'- CACTGTAACTTGAAGCAGCG -3'
(R):5'- AGTCTCAGATGCCTTAACCTG -3'
Posted On 2014-05-23