Incidental Mutation 'R0017:Kcnab1'
ID 19335
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Name potassium voltage-gated channel, shaker-related subfamily, beta member 1
Synonyms mKv(beta)1, Akr8a8, Kvbeta1.1
MMRRC Submission 038312-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0017 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 64856636-65285643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65264527 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 259 (V259M)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
AlphaFold P63143
Predicted Effect probably damaging
Transcript: ENSMUST00000049230
AA Change: V259M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: V259M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159525
SMART Domains Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 343 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161404
SMART Domains Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 284 4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161979
SMART Domains Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 50 355 1.2e-73 PFAM
Meta Mutation Damage Score 0.2010 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,226,938 (GRCm39) probably benign Het
Abca13 T A 11: 9,242,775 (GRCm39) I1546N probably damaging Het
Actrt3 A T 3: 30,652,422 (GRCm39) M224K probably benign Het
Adgrv1 T C 13: 81,727,065 (GRCm39) N429S probably benign Het
Appbp2 A C 11: 85,105,129 (GRCm39) C146G possibly damaging Het
Cabp2 A C 19: 4,136,242 (GRCm39) D83A possibly damaging Het
Ccl1 A G 11: 82,068,843 (GRCm39) probably null Het
Cdca8 T C 4: 124,814,168 (GRCm39) T208A probably benign Het
Dach1 C T 14: 98,406,184 (GRCm39) G188R probably damaging Het
Dcdc5 G A 2: 106,187,541 (GRCm39) noncoding transcript Het
Efr3b C A 12: 4,043,003 (GRCm39) C89F probably damaging Het
Enpp3 C T 10: 24,675,051 (GRCm39) probably null Het
Ep400 A T 5: 110,821,395 (GRCm39) V2467E probably damaging Het
Ermap T C 4: 119,037,145 (GRCm39) probably benign Het
Fig4 A G 10: 41,149,003 (GRCm39) Y150H possibly damaging Het
Fsip2 G A 2: 82,822,416 (GRCm39) V6050M probably damaging Het
Gnb1l T C 16: 18,359,810 (GRCm39) W72R probably damaging Het
Gpld1 A G 13: 25,174,101 (GRCm39) D842G probably damaging Het
Hmgcr A G 13: 96,788,597 (GRCm39) probably benign Het
Hrc A G 7: 44,985,794 (GRCm39) H315R possibly damaging Het
Ifit2 A T 19: 34,550,973 (GRCm39) N171I probably damaging Het
Ipo11 T A 13: 107,023,238 (GRCm39) I416L probably benign Het
Kcng4 T C 8: 120,360,259 (GRCm39) Y39C probably damaging Het
Kif5c A G 2: 49,622,725 (GRCm39) T526A probably benign Het
Kntc1 A G 5: 123,919,044 (GRCm39) Y805C probably damaging Het
Mal A G 2: 127,482,227 (GRCm39) S59P probably damaging Het
Myh15 A G 16: 48,983,423 (GRCm39) N1513D probably damaging Het
Ncoa2 A G 1: 13,244,976 (GRCm39) L574P probably damaging Het
Nmd3 A G 3: 69,643,425 (GRCm39) probably null Het
Nucb2 A G 7: 116,132,386 (GRCm39) D331G probably benign Het
Nwd1 T C 8: 73,436,053 (GRCm39) probably benign Het
Nynrin T C 14: 56,109,852 (GRCm39) F1653S probably damaging Het
Or4a80 A C 2: 89,582,365 (GRCm39) I269S possibly damaging Het
Or7c19 T A 8: 85,957,706 (GRCm39) I194N probably benign Het
Or8b12b T G 9: 37,684,274 (GRCm39) F106L probably benign Het
Pfdn6 T C 17: 34,158,538 (GRCm39) R79G probably damaging Het
Pkd1 G T 17: 24,797,513 (GRCm39) probably null Het
Pramel4 T G 4: 143,794,914 (GRCm39) C434G probably benign Het
Ptpn13 T C 5: 103,634,638 (GRCm39) probably null Het
Ptpro T C 6: 137,393,825 (GRCm39) V831A probably benign Het
Rabl6 A T 2: 25,492,579 (GRCm39) probably benign Het
Reg3b T A 6: 78,349,844 (GRCm39) M128K possibly damaging Het
Rif1 A G 2: 52,006,686 (GRCm39) T2207A probably benign Het
Rpa1 A C 11: 75,205,687 (GRCm39) N223K probably null Het
Rras2 T C 7: 113,647,490 (GRCm39) probably benign Het
Ryr1 T A 7: 28,746,967 (GRCm39) E3760V probably damaging Het
Scyl3 T A 1: 163,767,538 (GRCm39) I204N possibly damaging Het
Serpinb9h A C 13: 33,588,494 (GRCm39) I360L probably damaging Het
Slc16a12 A G 19: 34,650,098 (GRCm39) probably benign Het
Slc22a1 A G 17: 12,878,646 (GRCm39) F356L probably damaging Het
Slc22a29 A G 19: 8,195,630 (GRCm39) probably benign Het
Slc45a1 C A 4: 150,714,023 (GRCm39) D741Y possibly damaging Het
Slco1a5 A T 6: 142,182,061 (GRCm39) probably benign Het
Smg5 G T 3: 88,258,412 (GRCm39) R461L probably damaging Het
Snrk T C 9: 121,995,306 (GRCm39) S362P probably damaging Het
Spata31d1b A G 13: 59,863,883 (GRCm39) S344G probably benign Het
Sync G A 4: 129,187,537 (GRCm39) V190M probably damaging Het
Taf5l T C 8: 124,730,383 (GRCm39) Y67C probably damaging Het
Tbkbp1 A G 11: 97,037,115 (GRCm39) probably benign Het
Tshr A T 12: 91,504,660 (GRCm39) I533F possibly damaging Het
Tsn T C 1: 118,228,589 (GRCm39) D211G probably damaging Het
Ttn G A 2: 76,621,988 (GRCm39) T15518I probably benign Het
Unc13c T C 9: 73,600,583 (GRCm39) D1387G probably benign Het
Vapb A G 2: 173,613,397 (GRCm39) T99A probably benign Het
Vmn2r127 A G 17: 19,373,879 (GRCm39) noncoding transcript Het
Zfp280d A T 9: 72,246,292 (GRCm39) probably null Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65,226,875 (GRCm39) missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65,265,695 (GRCm39) missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65,264,503 (GRCm39) missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65,209,600 (GRCm39) missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65,265,741 (GRCm39) missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65,209,615 (GRCm39) critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65,283,933 (GRCm39) missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65,272,060 (GRCm39) missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65,017,368 (GRCm39) missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65,264,435 (GRCm39) splice site probably benign
R3916:Kcnab1 UTSW 3 65,211,585 (GRCm39) critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65,207,035 (GRCm39) missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65,204,896 (GRCm39) intron probably benign
R4796:Kcnab1 UTSW 3 65,211,586 (GRCm39) critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65,283,976 (GRCm39) missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65,226,908 (GRCm39) missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65,283,952 (GRCm39) missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65,173,924 (GRCm39) missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65,264,554 (GRCm39) missense probably benign 0.08
Z1177:Kcnab1 UTSW 3 65,173,931 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGGATTCCCCACATTTGGTACTTC -3'
(R):5'- GCTTGTGAATGCTTGCTCAGTCTACTC -3'

Sequencing Primer
(F):5'- CTCTTGGTGATATTTATGGTCACAAC -3'
(R):5'- CCCAGTACCTTGTAGACGATG -3'
Posted On 2013-04-11