Mutagenetix > Incidental Mutations

Incidental Mutation 'R0017:Sync'

19340

Institutional Source

Beutler Lab

Gene Symbol

Sync

Ensembl Gene

ENSMUSG00000001333

Gene Name

syncoilin

Synonyms

1110057H03Rik, SNIP4

MMRRC Submission

038312-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R0017 (G1)

Quality Score

216

Status

Validated (trace)

Chromosome

Chromosomal Location

129287617-129308559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129293744 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 190 (V190M)

Ref Sequence

ENSEMBL: ENSMUSP00000099659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102599]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102599
AA Change: V190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: V190M

Domain	Start	End	E-Value	Type
low complexity region	65	75	N/A	INTRINSIC
Filament	156	453	1.2e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146448

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.0%
20x: 89.2%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	T	17: 9,008,106		probably benign	Het
Abca13	T	A	11: 9,292,775	I1546N	probably damaging	Het
Actrt3	A	T	3: 30,598,273	M224K	probably benign	Het
Adgrv1	T	C	13: 81,578,946	N429S	probably benign	Het
Appbp2	A	C	11: 85,214,303	C146G	possibly damaging	Het
Cabp2	A	C	19: 4,086,242	D83A	possibly damaging	Het
Ccl1	A	G	11: 82,178,017		probably null	Het
Cdca8	T	C	4: 124,920,375	T208A	probably benign	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Dcdc5	G	A	2: 106,357,196		noncoding transcript	Het
Efr3b	C	A	12: 3,993,003	C89F	probably damaging	Het
Enpp3	C	T	10: 24,799,153		probably null	Het
Ep400	A	T	5: 110,673,529	V2467E	probably damaging	Het
Ermap	T	C	4: 119,179,948		probably benign	Het
Fig4	A	G	10: 41,273,007	Y150H	possibly damaging	Het
Fsip2	G	A	2: 82,992,072	V6050M	probably damaging	Het
Gm11397	A	C	13: 33,404,511	I360L	probably damaging	Het
Gnb1l	T	C	16: 18,541,060	W72R	probably damaging	Het
Gpld1	A	G	13: 24,990,118	D842G	probably damaging	Het
Hmgcr	A	G	13: 96,652,089		probably benign	Het
Hrc	A	G	7: 45,336,370	H315R	possibly damaging	Het
Ifit2	A	T	19: 34,573,573	N171I	probably damaging	Het
Ipo11	T	A	13: 106,886,730	I416L	probably benign	Het
Kcnab1	G	A	3: 65,357,106	V259M	probably damaging	Het
Kcng4	T	C	8: 119,633,520	Y39C	probably damaging	Het
Kif5c	A	G	2: 49,732,713	T526A	probably benign	Het
Kntc1	A	G	5: 123,780,981	Y805C	probably damaging	Het
Mal	A	G	2: 127,640,307	S59P	probably damaging	Het
Myh15	A	G	16: 49,163,060	N1513D	probably damaging	Het
Ncoa2	A	G	1: 13,174,752	L574P	probably damaging	Het
Nmd3	A	G	3: 69,736,092		probably null	Het
Nucb2	A	G	7: 116,533,151	D331G	probably benign	Het
Nwd1	T	C	8: 72,709,425		probably benign	Het
Nynrin	T	C	14: 55,872,395	F1653S	probably damaging	Het
Olfr1253	A	C	2: 89,752,021	I269S	possibly damaging	Het
Olfr371	T	A	8: 85,231,077	I194N	probably benign	Het
Olfr875	T	G	9: 37,772,978	F106L	probably benign	Het
Pfdn6	T	C	17: 33,939,564	R79G	probably damaging	Het
Pkd1	G	T	17: 24,578,539		probably null	Het
Pramel4	T	G	4: 144,068,344	C434G	probably benign	Het
Ptpn13	T	C	5: 103,486,772		probably null	Het
Ptpro	T	C	6: 137,416,827	V831A	probably benign	Het
Rabl6	A	T	2: 25,602,567		probably benign	Het
Reg3b	T	A	6: 78,372,861	M128K	possibly damaging	Het
Rif1	A	G	2: 52,116,674	T2207A	probably benign	Het
Rpa1	A	C	11: 75,314,861	N223K	probably null	Het
Rras2	T	C	7: 114,048,255		probably benign	Het
Ryr1	T	A	7: 29,047,542	E3760V	probably damaging	Het
Scyl3	T	A	1: 163,939,969	I204N	possibly damaging	Het
Slc16a12	A	G	19: 34,672,698		probably benign	Het
Slc22a1	A	G	17: 12,659,759	F356L	probably damaging	Het
Slc22a29	A	G	19: 8,218,266		probably benign	Het
Slc45a1	C	A	4: 150,629,566	D741Y	possibly damaging	Het
Slco1a5	A	T	6: 142,236,335		probably benign	Het
Smg5	G	T	3: 88,351,105	R461L	probably damaging	Het
Snrk	T	C	9: 122,166,240	S362P	probably damaging	Het
Spata31d1b	A	G	13: 59,716,069	S344G	probably benign	Het
Taf5l	T	C	8: 124,003,644	Y67C	probably damaging	Het
Tbkbp1	A	G	11: 97,146,289		probably benign	Het
Tshr	A	T	12: 91,537,886	I533F	possibly damaging	Het
Tsn	T	C	1: 118,300,859	D211G	probably damaging	Het
Ttn	G	A	2: 76,791,644	T15518I	probably benign	Het
Unc13c	T	C	9: 73,693,301	D1387G	probably benign	Het
Vapb	A	G	2: 173,771,604	T99A	probably benign	Het
Vmn2r-ps119	A	G	17: 19,153,617		noncoding transcript	Het
Zfp280d	A	T	9: 72,339,010		probably null	Het

Other mutations in Sync

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02629:Sync	APN	4	129293951	missense	probably damaging	0.99
PIT4354001:Sync	UTSW	4	129306654	missense	possibly damaging	0.71
R0017:Sync	UTSW	4	129293744	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0825:Sync	UTSW	4	129293397	missense	probably benign	0.04
R0846:Sync	UTSW	4	129294104	missense	probably benign	0.13
R3824:Sync	UTSW	4	129294363	missense	possibly damaging	0.95
R4151:Sync	UTSW	4	129293726	nonsense	probably null
R4166:Sync	UTSW	4	129306742	intron	probably benign
R4760:Sync	UTSW	4	129293439	missense	probably benign	0.01
R5753:Sync	UTSW	4	129293386	nonsense	probably null
R6120:Sync	UTSW	4	129293751	missense	probably damaging	1.00
R6578:Sync	UTSW	4	129294267	missense	probably damaging	1.00
R6860:Sync	UTSW	4	129287790	critical splice donor site	probably null
R7347:Sync	UTSW	4	129294306	missense	probably benign	0.22
R7612:Sync	UTSW	4	129293582	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CGCCAGATGAGGTGCAAATTTCAG -3'
(R):5'- TAAGCCACGCATTCCTTGGTCAC -3'

Sequencing Primer
(F):5'- TAAGAGCCCAACTGCTTGTG -3'
(R):5'- GGTCACCTTGAACAGCTTCTG -3'

Posted On

2013-04-11