Incidental Mutation 'R0017:Sync'
ID19340
Institutional Source Beutler Lab
Gene Symbol Sync
Ensembl Gene ENSMUSG00000001333
Gene Namesyncoilin
Synonyms1110057H03Rik, SNIP4
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0017 (G1)
Quality Score216
Status Validated (trace)
Chromosome4
Chromosomal Location129287617-129308559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129293744 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 190 (V190M)
Ref Sequence ENSEMBL: ENSMUSP00000099659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102599]
Predicted Effect probably damaging
Transcript: ENSMUST00000102599
AA Change: V190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: V190M

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Filament 156 453 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146448
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Sync
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Sync APN 4 129293951 missense probably damaging 0.99
PIT4354001:Sync UTSW 4 129306654 missense possibly damaging 0.71
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0825:Sync UTSW 4 129293397 missense probably benign 0.04
R0846:Sync UTSW 4 129294104 missense probably benign 0.13
R3824:Sync UTSW 4 129294363 missense possibly damaging 0.95
R4151:Sync UTSW 4 129293726 nonsense probably null
R4166:Sync UTSW 4 129306742 intron probably benign
R4760:Sync UTSW 4 129293439 missense probably benign 0.01
R5753:Sync UTSW 4 129293386 nonsense probably null
R6120:Sync UTSW 4 129293751 missense probably damaging 1.00
R6578:Sync UTSW 4 129294267 missense probably damaging 1.00
R6860:Sync UTSW 4 129287790 critical splice donor site probably null
R7347:Sync UTSW 4 129294306 missense probably benign 0.22
R7612:Sync UTSW 4 129293582 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGCCAGATGAGGTGCAAATTTCAG -3'
(R):5'- TAAGCCACGCATTCCTTGGTCAC -3'

Sequencing Primer
(F):5'- TAAGAGCCCAACTGCTTGTG -3'
(R):5'- GGTCACCTTGAACAGCTTCTG -3'
Posted On2013-04-11