Incidental Mutation 'R0017:Ep400'
ID 19343
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms 1700020J09Rik, p400, mDomino
MMRRC Submission 038312-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0017 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 5
Chromosomal Location 110812239-110918583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110821395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2467 (V2467E)
Ref Sequence ENSEMBL: ENSMUSP00000108054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041558
AA Change: V2586E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: V2586E

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112435
AA Change: V2467E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: V2467E

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112436
AA Change: V2550E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: V2550E

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177596
Meta Mutation Damage Score 0.2401 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,226,938 (GRCm39) probably benign Het
Abca13 T A 11: 9,242,775 (GRCm39) I1546N probably damaging Het
Actrt3 A T 3: 30,652,422 (GRCm39) M224K probably benign Het
Adgrv1 T C 13: 81,727,065 (GRCm39) N429S probably benign Het
Appbp2 A C 11: 85,105,129 (GRCm39) C146G possibly damaging Het
Cabp2 A C 19: 4,136,242 (GRCm39) D83A possibly damaging Het
Ccl1 A G 11: 82,068,843 (GRCm39) probably null Het
Cdca8 T C 4: 124,814,168 (GRCm39) T208A probably benign Het
Dach1 C T 14: 98,406,184 (GRCm39) G188R probably damaging Het
Dcdc5 G A 2: 106,187,541 (GRCm39) noncoding transcript Het
Efr3b C A 12: 4,043,003 (GRCm39) C89F probably damaging Het
Enpp3 C T 10: 24,675,051 (GRCm39) probably null Het
Ermap T C 4: 119,037,145 (GRCm39) probably benign Het
Fig4 A G 10: 41,149,003 (GRCm39) Y150H possibly damaging Het
Fsip2 G A 2: 82,822,416 (GRCm39) V6050M probably damaging Het
Gnb1l T C 16: 18,359,810 (GRCm39) W72R probably damaging Het
Gpld1 A G 13: 25,174,101 (GRCm39) D842G probably damaging Het
Hmgcr A G 13: 96,788,597 (GRCm39) probably benign Het
Hrc A G 7: 44,985,794 (GRCm39) H315R possibly damaging Het
Ifit2 A T 19: 34,550,973 (GRCm39) N171I probably damaging Het
Ipo11 T A 13: 107,023,238 (GRCm39) I416L probably benign Het
Kcnab1 G A 3: 65,264,527 (GRCm39) V259M probably damaging Het
Kcng4 T C 8: 120,360,259 (GRCm39) Y39C probably damaging Het
Kif5c A G 2: 49,622,725 (GRCm39) T526A probably benign Het
Kntc1 A G 5: 123,919,044 (GRCm39) Y805C probably damaging Het
Mal A G 2: 127,482,227 (GRCm39) S59P probably damaging Het
Myh15 A G 16: 48,983,423 (GRCm39) N1513D probably damaging Het
Ncoa2 A G 1: 13,244,976 (GRCm39) L574P probably damaging Het
Nmd3 A G 3: 69,643,425 (GRCm39) probably null Het
Nucb2 A G 7: 116,132,386 (GRCm39) D331G probably benign Het
Nwd1 T C 8: 73,436,053 (GRCm39) probably benign Het
Nynrin T C 14: 56,109,852 (GRCm39) F1653S probably damaging Het
Or4a80 A C 2: 89,582,365 (GRCm39) I269S possibly damaging Het
Or7c19 T A 8: 85,957,706 (GRCm39) I194N probably benign Het
Or8b12b T G 9: 37,684,274 (GRCm39) F106L probably benign Het
Pfdn6 T C 17: 34,158,538 (GRCm39) R79G probably damaging Het
Pkd1 G T 17: 24,797,513 (GRCm39) probably null Het
Pramel4 T G 4: 143,794,914 (GRCm39) C434G probably benign Het
Ptpn13 T C 5: 103,634,638 (GRCm39) probably null Het
Ptpro T C 6: 137,393,825 (GRCm39) V831A probably benign Het
Rabl6 A T 2: 25,492,579 (GRCm39) probably benign Het
Reg3b T A 6: 78,349,844 (GRCm39) M128K possibly damaging Het
Rif1 A G 2: 52,006,686 (GRCm39) T2207A probably benign Het
Rpa1 A C 11: 75,205,687 (GRCm39) N223K probably null Het
Rras2 T C 7: 113,647,490 (GRCm39) probably benign Het
Ryr1 T A 7: 28,746,967 (GRCm39) E3760V probably damaging Het
Scyl3 T A 1: 163,767,538 (GRCm39) I204N possibly damaging Het
Serpinb9h A C 13: 33,588,494 (GRCm39) I360L probably damaging Het
Slc16a12 A G 19: 34,650,098 (GRCm39) probably benign Het
Slc22a1 A G 17: 12,878,646 (GRCm39) F356L probably damaging Het
Slc22a29 A G 19: 8,195,630 (GRCm39) probably benign Het
Slc45a1 C A 4: 150,714,023 (GRCm39) D741Y possibly damaging Het
Slco1a5 A T 6: 142,182,061 (GRCm39) probably benign Het
Smg5 G T 3: 88,258,412 (GRCm39) R461L probably damaging Het
Snrk T C 9: 121,995,306 (GRCm39) S362P probably damaging Het
Spata31d1b A G 13: 59,863,883 (GRCm39) S344G probably benign Het
Sync G A 4: 129,187,537 (GRCm39) V190M probably damaging Het
Taf5l T C 8: 124,730,383 (GRCm39) Y67C probably damaging Het
Tbkbp1 A G 11: 97,037,115 (GRCm39) probably benign Het
Tshr A T 12: 91,504,660 (GRCm39) I533F possibly damaging Het
Tsn T C 1: 118,228,589 (GRCm39) D211G probably damaging Het
Ttn G A 2: 76,621,988 (GRCm39) T15518I probably benign Het
Unc13c T C 9: 73,600,583 (GRCm39) D1387G probably benign Het
Vapb A G 2: 173,613,397 (GRCm39) T99A probably benign Het
Vmn2r127 A G 17: 19,373,879 (GRCm39) noncoding transcript Het
Zfp280d A T 9: 72,246,292 (GRCm39) probably null Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110,835,707 (GRCm39) missense unknown
IGL00585:Ep400 APN 5 110,903,771 (GRCm39) missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110,887,460 (GRCm39) missense probably damaging 1.00
IGL00816:Ep400 APN 5 110,883,356 (GRCm39) unclassified probably benign
IGL01066:Ep400 APN 5 110,816,065 (GRCm39) splice site probably benign
IGL01302:Ep400 APN 5 110,889,914 (GRCm39) missense probably benign 0.00
IGL01568:Ep400 APN 5 110,867,361 (GRCm39) missense unknown
IGL01833:Ep400 APN 5 110,827,874 (GRCm39) missense unknown
IGL02086:Ep400 APN 5 110,824,809 (GRCm39) splice site probably benign
IGL02266:Ep400 APN 5 110,843,163 (GRCm39) unclassified probably benign
IGL02288:Ep400 APN 5 110,831,702 (GRCm39) splice site probably benign
IGL02301:Ep400 APN 5 110,822,826 (GRCm39) missense probably damaging 1.00
IGL02377:Ep400 APN 5 110,868,691 (GRCm39) missense unknown
IGL02382:Ep400 APN 5 110,849,594 (GRCm39) missense unknown
IGL02419:Ep400 APN 5 110,845,242 (GRCm39) splice site probably null
IGL02591:Ep400 APN 5 110,881,638 (GRCm39) unclassified probably benign
IGL02981:Ep400 APN 5 110,839,476 (GRCm39) splice site probably benign
IGL02981:Ep400 APN 5 110,903,969 (GRCm39) missense possibly damaging 0.79
IGL03173:Ep400 APN 5 110,856,737 (GRCm39) unclassified probably benign
IGL03244:Ep400 APN 5 110,875,429 (GRCm39) missense unknown
IGL03333:Ep400 APN 5 110,851,432 (GRCm39) missense unknown
santol UTSW 5 110,849,537 (GRCm39) missense unknown
PIT4243001:Ep400 UTSW 5 110,883,446 (GRCm39) missense unknown
PIT4260001:Ep400 UTSW 5 110,841,037 (GRCm39) nonsense probably null
R0179:Ep400 UTSW 5 110,816,515 (GRCm39) missense probably damaging 0.99
R0243:Ep400 UTSW 5 110,872,273 (GRCm39) splice site probably benign
R0366:Ep400 UTSW 5 110,849,537 (GRCm39) missense unknown
R0508:Ep400 UTSW 5 110,887,374 (GRCm39) missense probably benign 0.00
R0541:Ep400 UTSW 5 110,852,882 (GRCm39) missense unknown
R0558:Ep400 UTSW 5 110,832,933 (GRCm39) splice site probably benign
R0576:Ep400 UTSW 5 110,858,959 (GRCm39) unclassified probably benign
R0595:Ep400 UTSW 5 110,851,408 (GRCm39) missense unknown
R0671:Ep400 UTSW 5 110,836,062 (GRCm39) missense unknown
R0763:Ep400 UTSW 5 110,813,703 (GRCm39) missense probably damaging 1.00
R1078:Ep400 UTSW 5 110,883,388 (GRCm39) unclassified probably benign
R1300:Ep400 UTSW 5 110,821,426 (GRCm39) missense probably damaging 1.00
R1439:Ep400 UTSW 5 110,833,344 (GRCm39) missense unknown
R1520:Ep400 UTSW 5 110,839,644 (GRCm39) intron probably benign
R1529:Ep400 UTSW 5 110,887,311 (GRCm39) missense probably benign 0.00
R1535:Ep400 UTSW 5 110,856,032 (GRCm39) unclassified probably benign
R1560:Ep400 UTSW 5 110,818,972 (GRCm39) splice site probably null
R1587:Ep400 UTSW 5 110,874,768 (GRCm39) missense probably benign 0.23
R1596:Ep400 UTSW 5 110,856,727 (GRCm39) unclassified probably benign
R1653:Ep400 UTSW 5 110,841,040 (GRCm39) nonsense probably null
R1711:Ep400 UTSW 5 110,841,174 (GRCm39) unclassified probably benign
R1774:Ep400 UTSW 5 110,833,357 (GRCm39) missense unknown
R1836:Ep400 UTSW 5 110,852,920 (GRCm39) missense unknown
R1905:Ep400 UTSW 5 110,818,814 (GRCm39) missense probably damaging 1.00
R1917:Ep400 UTSW 5 110,851,441 (GRCm39) missense unknown
R2064:Ep400 UTSW 5 110,883,270 (GRCm39) unclassified probably benign
R2122:Ep400 UTSW 5 110,856,716 (GRCm39) unclassified probably benign
R2144:Ep400 UTSW 5 110,851,384 (GRCm39) missense unknown
R2215:Ep400 UTSW 5 110,841,421 (GRCm39) unclassified probably benign
R2252:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2253:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2483:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R2504:Ep400 UTSW 5 110,816,511 (GRCm39) missense probably damaging 1.00
R2512:Ep400 UTSW 5 110,856,781 (GRCm39) unclassified probably benign
R2842:Ep400 UTSW 5 110,846,681 (GRCm39) nonsense probably null
R2920:Ep400 UTSW 5 110,903,780 (GRCm39) missense probably damaging 1.00
R3082:Ep400 UTSW 5 110,841,096 (GRCm39) unclassified probably benign
R3151:Ep400 UTSW 5 110,851,435 (GRCm39) missense unknown
R3552:Ep400 UTSW 5 110,877,153 (GRCm39) missense unknown
R3623:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R3779:Ep400 UTSW 5 110,839,515 (GRCm39) missense unknown
R3923:Ep400 UTSW 5 110,904,389 (GRCm39) missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110,889,847 (GRCm39) missense probably benign 0.10
R4508:Ep400 UTSW 5 110,851,481 (GRCm39) missense unknown
R4584:Ep400 UTSW 5 110,881,763 (GRCm39) unclassified probably benign
R4585:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4586:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4807:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R4921:Ep400 UTSW 5 110,813,676 (GRCm39) missense probably damaging 1.00
R4976:Ep400 UTSW 5 110,868,622 (GRCm39) missense unknown
R4976:Ep400 UTSW 5 110,846,678 (GRCm39) missense unknown
R5075:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R5120:Ep400 UTSW 5 110,904,224 (GRCm39) missense probably damaging 1.00
R5122:Ep400 UTSW 5 110,816,036 (GRCm39) missense probably damaging 1.00
R5223:Ep400 UTSW 5 110,816,496 (GRCm39) missense probably damaging 1.00
R5284:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R5388:Ep400 UTSW 5 110,849,594 (GRCm39) missense unknown
R5401:Ep400 UTSW 5 110,831,037 (GRCm39) missense unknown
R5431:Ep400 UTSW 5 110,824,420 (GRCm39) missense unknown
R5461:Ep400 UTSW 5 110,824,550 (GRCm39) nonsense probably null
R5568:Ep400 UTSW 5 110,904,071 (GRCm39) missense probably damaging 1.00
R5650:Ep400 UTSW 5 110,843,818 (GRCm39) critical splice donor site probably null
R5778:Ep400 UTSW 5 110,867,450 (GRCm39) missense unknown
R5806:Ep400 UTSW 5 110,903,420 (GRCm39) nonsense probably null
R5814:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R5830:Ep400 UTSW 5 110,831,862 (GRCm39) missense unknown
R5882:Ep400 UTSW 5 110,903,453 (GRCm39) missense probably benign 0.00
R5931:Ep400 UTSW 5 110,883,386 (GRCm39) unclassified probably benign
R5945:Ep400 UTSW 5 110,830,732 (GRCm39) missense unknown
R5966:Ep400 UTSW 5 110,824,766 (GRCm39) missense unknown
R5973:Ep400 UTSW 5 110,877,697 (GRCm39) missense unknown
R5980:Ep400 UTSW 5 110,881,595 (GRCm39) unclassified probably benign
R6000:Ep400 UTSW 5 110,831,067 (GRCm39) missense unknown
R6006:Ep400 UTSW 5 110,852,825 (GRCm39) missense unknown
R6053:Ep400 UTSW 5 110,903,661 (GRCm39) missense probably benign 0.22
R6145:Ep400 UTSW 5 110,904,569 (GRCm39) missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110,903,799 (GRCm39) missense probably damaging 0.97
R6169:Ep400 UTSW 5 110,889,863 (GRCm39) missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110,818,808 (GRCm39) missense probably damaging 1.00
R6295:Ep400 UTSW 5 110,901,675 (GRCm39) missense probably benign 0.00
R6486:Ep400 UTSW 5 110,845,084 (GRCm39) unclassified probably benign
R6504:Ep400 UTSW 5 110,856,703 (GRCm39) unclassified probably benign
R6607:Ep400 UTSW 5 110,831,180 (GRCm39) missense unknown
R6657:Ep400 UTSW 5 110,841,411 (GRCm39) unclassified probably benign
R6660:Ep400 UTSW 5 110,867,313 (GRCm39) nonsense probably null
R6741:Ep400 UTSW 5 110,824,761 (GRCm39) missense unknown
R6933:Ep400 UTSW 5 110,813,728 (GRCm39) missense probably damaging 1.00
R6937:Ep400 UTSW 5 110,859,018 (GRCm39) unclassified probably benign
R7069:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R7103:Ep400 UTSW 5 110,881,651 (GRCm39) missense unknown
R7156:Ep400 UTSW 5 110,833,229 (GRCm39) missense unknown
R7272:Ep400 UTSW 5 110,903,511 (GRCm39) nonsense probably null
R7365:Ep400 UTSW 5 110,867,480 (GRCm39) missense unknown
R7581:Ep400 UTSW 5 110,903,891 (GRCm39) missense unknown
R7684:Ep400 UTSW 5 110,845,218 (GRCm39) missense unknown
R7699:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7700:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7856:Ep400 UTSW 5 110,814,450 (GRCm39) missense probably damaging 0.99
R7954:Ep400 UTSW 5 110,816,599 (GRCm39) missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110,841,117 (GRCm39) missense unknown
R8108:Ep400 UTSW 5 110,835,749 (GRCm39) missense unknown
R8260:Ep400 UTSW 5 110,903,478 (GRCm39) nonsense probably null
R8293:Ep400 UTSW 5 110,856,758 (GRCm39) missense unknown
R8314:Ep400 UTSW 5 110,903,619 (GRCm39) missense unknown
R8351:Ep400 UTSW 5 110,887,200 (GRCm39) missense probably damaging 1.00
R8424:Ep400 UTSW 5 110,841,144 (GRCm39) missense unknown
R8459:Ep400 UTSW 5 110,856,757 (GRCm39) missense unknown
R8529:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R8688:Ep400 UTSW 5 110,868,685 (GRCm39) missense unknown
R8744:Ep400 UTSW 5 110,889,925 (GRCm39) missense unknown
R8923:Ep400 UTSW 5 110,831,864 (GRCm39) missense unknown
R9005:Ep400 UTSW 5 110,858,959 (GRCm39) missense unknown
R9087:Ep400 UTSW 5 110,815,430 (GRCm39) nonsense probably null
R9146:Ep400 UTSW 5 110,849,635 (GRCm39) nonsense probably null
R9383:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R9479:Ep400 UTSW 5 110,877,730 (GRCm39) missense unknown
R9496:Ep400 UTSW 5 110,855,853 (GRCm39) missense unknown
R9582:Ep400 UTSW 5 110,824,315 (GRCm39) critical splice donor site probably null
R9607:Ep400 UTSW 5 110,831,805 (GRCm39) missense unknown
R9712:Ep400 UTSW 5 110,904,509 (GRCm39) missense unknown
R9746:Ep400 UTSW 5 110,889,872 (GRCm39) missense unknown
X0012:Ep400 UTSW 5 110,821,062 (GRCm39) small deletion probably benign
X0021:Ep400 UTSW 5 110,830,730 (GRCm39) missense unknown
Z1176:Ep400 UTSW 5 110,904,501 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,881,609 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,831,230 (GRCm39) missense unknown
Z1188:Ep400 UTSW 5 110,903,549 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTGCTGCCTAAGAAGCTGGAAATG -3'
(R):5'- GAATCCACTTTGCATGGAACAAGCC -3'

Sequencing Primer
(F):5'- CTCTTCTGGAGAATAATTGCAGGC -3'
(R):5'- GCCATTGAAACTATGGACTTCTGG -3'
Posted On 2013-04-11